Sign In

GLBRC Y22-3 ( GCA_001634645.1 ) - CM004295.1
Saccharomyces cerevisiae strain GLBRCY22-3 chromosome II, whole genome shotgun sequence

>CM004295.1 Saccharomyces cerevisiae strain GLBRCY22-3 chromosome II, whole genome shotgun sequence
GTAACCCAATTTTACGTTGTTGGTCCTAAAGGTGCACTCAACAATATTCTCCCACGCAGCTATCCTGTCTGTGAAATTAGTGCTAGCAAGATCATCGTAG
ATCCCCACGTATAAATCAGTAACGCCATCGCAACCTTCTTCAATAAAGTTTCTTACAGGGGCCACATTCAAGCAACCGCATCGGCCCAACCTGATCATGC
AATTAGCAAGCAACACTGTGTACGGTACAAACAGAAACGACACATATTTCACGTCGCCCTTAGACGCCAGTGCTATCAAGGGGAGATGAAATAACTCCGT
CTTACCATAGCCCGGTGGGGCCTGTACTGCCACAGAGGGTGTGTCTGCCATGTATATTTCATGACATAAGCGCAACTGATGCAAGTCCCTGAATTCAAAG
GAGCTGCCAAAGAGTTTCTGGCCTGCGACGAGGATATCGTTTGTACTCTTGGGCTCTCGGGGCCTTTTTCGCGTTACTCTTGAAATTTTTTGATCATGAT
CTGAACTCGCCGCCTCACCTGCCACTACGTCTTCCGCATTCCGAGTACTAGAGAATGAACAATGGTAGTCGCTTTCAAGGCCTAACCATTGAATCCAGCG
CTCGGAAGTGAGTCCGTCAAGCGTCTTTAGTCGAGGCTCCGATGAACCGTTCTTGTTGTATCGTCGACGTATACGTTGCGCTGTAGCTCTGGATAACGGT
AAGCGTATCACCGTAAGCTCGTCAATTATTTTTGAGAGCCGCGGTCATTTTGTTAGTATCTCTTCTCAACTTGGGCAGCACACATGCAAAACATCACCCA
ATCGGCCCTTTTTGTTCATCATATCGTTACATATCTGTGAAAAGTACTTTATCTCAGTGGGTTTACGTGGGCATAGATCACGCTTCAGCCGCTCTGTGTC
GACTTTCTTTTCGCCAGGTAAACTTGCTTGGTATGCAGAAAAAATCGATAGCTCATCTACGTGTAGTAACAAAAACATGTAGGGTGCCAAATTGTATCCA
TATTTCCTTATGGTGCTTTTCTGAAGACTCCTTACAATAGGTGTGCCAGAAACAAAGTCAGTGAAAGTACGCATCGTAGAGCTGTCGTTCGCCTGGCACT
CGCTATTTCGTGACAACGTTCCAGGACACGGAAACTCAACTCATTATAGTATCCTCTGTTGAGGTAAAAAAGAGAAAGGGTATCGTAATCCTTTCTATTG
AATTTCAAAGTATGCACTTGAAACAACGTGTAGACCATCAAGTTGATTTTCTTGGGAATAAGATACTTTGAAGGGATTGGTCCGCCCTGGAAATCTGGTT
CGTCTTCAACAGACGTCAGGAACTTTTGTACATTTTTCCCGACCATGACGGAAACGACAATTTTTTCAAAAGACCTTTTCCTATCCATTGCACCAGTTCT
GAATTTTACCACTTTGATTAGACCAGACTTTTCGTCTTCGTAGAATGACCGCACTTCCGTGGGGATCGATTCAAATAAAGTTATTGAGGGACAATGTACC
AAGTCGTTCTTGTTATTTAGAGCCAACTCGAACTCGTCAAAGTTTGCTTTTTCAAACTTACGCCTATCGGAAACTTTCATTTTATTTTTGTAAGTTTCGA
AATTAACAATAGTATGTTGATTGTTATGCTTTTTGACAAGAAATCCATCAATATAAACAAAAGATTGTCCAGTTTCCGTCTTATCATCATCTAAGAATGT
AATAATTAAGCTACTCTATTGAGAAGAAGCAGAATCTGCGCTATGCAGGTGCAAATCTCCAGCAGCAGCAAAGAAAATTCAGTTAATAAGAAATCTCACT
AAGATAAGCGACTGTCTGTCCCAACATAGAAAACAGAAGGATGTCTCATTCATCCTTGATTTCCGGCCTGCAAAAATAAAGTAGTCGGTACGTACGTTCG
TTTTCAATTTCCATGGTGCACAGTATCTTAACTATCTGCTTAGTCGAGGAGAACCAGGATTCTGTTCGTTGCTCAGCCGCTTCGTGGATATTCTCTTGGA
TACTTTAAATATGGGCCTACGCTTAGCCTGCGCTTAGCCTACAACTTCTTCCGCTCTCGAAAAGACCAATATAATAGAAAGTTATAAATTACATTTCCTT
ATTAGGTATACGACCTCGCGCTTCGAAGTAGAGGAGCCCTTTTTGGCGTACCTACATATGGCGCGTCAGACAGACAAACTTCCCCAAAAATGTATTACCC
CGCCGAATAAGAAAACAGACCCATTCACCCACGACGTATCAAGTTACTTCCTTGGTGCAATGTCCCACTATAAAAAAATTCCTTGACGCTAGATCGTTGG
ACTAAAATCTGCGTCACAATCGCCTAAACAGGAAATATCGCCTATTTTCGTACAAGGTTACTTCCTAGATGCTATATGTCCCTACGGCCTTGTCTAACAC
CATCCAGCATGCAATAAGGTGACATATATATACCCACCACACCCACACCCACACCCACACCCACACACCACACCCACACACACCACACCCACACCACACC
CACACCACACCACACCCCACACCACACCACACACCACACCCACACACCACACCCACACCCACACCCACACCACACCCACACCCACACCACACCACACCCA
CACACCACACCCACACCAACTCTCTCTCATCTACCTTTACTCGCGCTGTCACACCTTACCCGGCTTTCTGACCGAAATTAAAAAAAATGAAAATGAAATC
CTGTTCTTTAGCCCTACAACACTTTTACATAGCCCTAAATAGCCCTAAATAGCCCTCATTTACGTCTCCTCCAAGCCCTATTGACTCTTACCCGGAGTTT
CAGCTAAAAGCTATACTTACTACCTTTATTTTATGTTTACTTTTTATAGACTGTCTTTTTCATCCTACTCCTTCGCACTTGTCTCTCGCTACTGCCGTGC
AACAAACACTAAATCAAAACAGTAAAATACTACATCAAAACGCATATTCCCTAGAAAAAAATTTTCTTACAATATACTATACTACACAATACATAATCAC
TGACTTTCGTAACAACAATTTCCTTCACTCTCCAACTTCTCTGCTCGAATCTCTACATAGTAATATTATATCAAATCTACCGTCTGGAACATCATCGCTA
TCCAGCTCTTTGTGAACCGCTACCATCAGCATGTACAGCGGTACCCTCGTGTTATCTGCAGCGAGAACTTCAACGTTTGCCAAATCAAGCCAATGTGGTA
ACAACCACACCTCCGAAATCTGCTCCAAAAGATACTCCAGTTTCTGCCGAAATGTTTTATTGCAGAACAGCCCTATCAGCATCGACAGGAATGCCGTCCA
ATGCGGCACTTCAGATGGGGTAACTCCCAGCGCAAGCTGATCTCGCAAGTGCATTCCTAGACTTAATTCATATCTGCTCCTCAACTGTCGATGATGCCTG
CTAAACTGCAGCTTGACGTACTGCGGACCCTGCAGTCCAGCGCTCGTCATGGAACGCAAACGCTGAAAAACTCCAACTTTCTCGAGCGCTTCCACAAAGA
CCGTATCGTCTTTTGCCTCCCATTCTTCCCGGCACTTTTTCTCGTCCCAGTTCAAAAAGTACTGCAGCACCTCTGTCTTCGATTCACGCAGGTTGCTCCA
TACTTTATAATACAACTCTTTGATCTGCCTTCCAGACATGCGGAAAACTTGGCTCCCTTGCTTGCCTCTTGTCGAATCCAATACACTAATTGTTTCTCTT
CTTCTAGTAATGGCCAGGTACCAAGCATAATTTCTCTGTATCTGAGAGTAGATCTCTCCCCTTTTTACGCTAAAAAATTTCAAATACCCTACAGGGTCCC
CATGATATGGCTCGATGTCTTCCAAGTATTCTTTGTATTCCTCGTCATTTCGCAGCATTCTCTCCACAGCTAGTGCTTCCCAAGCCATCCTCCGATACGA
TACTTTCTGGCCAGCCCAACAGACACAGAGCTCGAACATCTTTTGACAGCCCTTGCATAATCCGTATTGTGTGAATACTCCCTCTGGGCAGAAGTATACG
TCAATACCATAGAGGAAAAGATGTTTAATTTCGTCAGACCGAAATCCAAGAAACTGTAAGACATTCATATTCTCGGAAGTATTGGGAAATTGTGCTTTCA
GTTTCTTTCTCTCTAGCAAAACCATTTGACTCCCTTTCCGCTTATACGACTCTTTGTTAATGTCGGTGACTGGATGGAATCTATTATCCTCAGCATTGCC
ATCTTTATTGGCGTCCTCCTTGGCACTAGCGTTGGTACTTTCAGTGGTAGTAGCATTAGTGCTGGAGTTGGTGCTAGCAGTGGTAGTAGCACTAGTGTTG
GAGTTGGTACCTTCAGTGGTAGTAGCATTAGTGCTGGAGTTGGTACTTTCAGTGGTAGTAGCATTAGTGTTGGAGTTGGTACTTTCAGTGGTAGTCGCAC
TAGTCCTGACGTTGATGCTGGCAGTGGTAGTAGCATTAGTGCTGGAGTTGGTACTTTCAGTGGTAGTAGCACTAGTGTTGGAGTCGGTACTTTCGGTGGT
AGTAGCACTAGTGTTGGAGTTGGTACTTTCAGTGGTAGTCGCACTAGTCCTGACGTTGATGCTGGCAGTGGTAGTAGCACTAGTCCTGACGTTGGTGCTG
GCAGTGGTAGTAGCATTAGTGCTGGAGTTGGTACTTTCAGTGGTAGTCGCACTAGTCCTGACGTTGATGCTGGCAGTGGTAGTAGCACTAGTCCTGACGT
TGGTGCTGGCAGTGGTAGTAGCATTAGTGCTGGAGTTGGTAGTCGCATTGGTACTGGCATTAGCACTACCATGAATGCACGTGTCGCTGTCCTCATCACT
GCTGCAATACTTTCTGCACCTGTCACTGCTATTGCTCTCCTGGAAGCTAGACGGTAACGCAACGATCGACATGGAAGCTGTCGCCTGTTTTTCAGCCAAT
CTGTCCATTCTTTCTATCAGTTCCACTGTGTCAGCAGACAGGTCTGTCCTGGAGCCACAGCATCCAACATGCTGGCCCTTTTTTCCTTTCTTTGATTCAA
GTCCATAGAACTCGCGTACCTGTTCGGTTATACAGCCTTCCTTAATCGGTGGTAATTCACCCTTACGATTCCTTGCCGCCCAACTGTTTTTTCTAGATAA
TAGATAACAGAGGCCCCCATCTCTTAGTCTCCCTACGCCTTGAATGAGCTCAATAATATTAAGTCTATTATCAAGCATGATCACCATCATCAATTGCTTA
ATGTCAATTCCTTCAGTCACTAATTTCGTTCCGATGAGAACTCGCATGCTACCGTCAGTGACAAACTCCTTTGTGCGAGACACCTTTTCTGCAGCACCCA
GCTTCCCGTGTATCCATACCACCCTAAAATACTTTCTCCAAGAGCAGGCCAATTCTTCCACTTCGTTGGTTGTGCTTGCAACTACAATGGCCTTCGACTC
TGGTTCAATTTCAAAGAGGGCTAAAAGAAGCTTCAGTGCTTCTTCGGGCTGTGATTCCACTTTCTTCCAAATTTTATGAACATGCCCTAAAGGCACCTCG
GATTTCTCCTTGATTAGATTAAACATCCGTGTTGGATAGCTGGATAGACCTCTGCTGAGATCTTCCGACCGTTTGAGCTCGTTGATGTCCATCGACTTCT
TGGCCAGTCCCGTAAGCCCAATACGCTGCAACGCAGCATCAGCTACAGCCTCAGGTGCTGTGCCGCTCAAAAAGATTGCTTTCTCAAAAGCGTCAAAATC
AAGGTTAGTTATGCCCCCAAATTGCGACTGCCGGTAGACCTCCGTTTCAAAGTTGTGAAACTCATCTACAATGAGGTAACCCAATTTTACGTTGTTGGTC
CTAAAGGTGCACTCAACAATATTCTCCCACGCAGCTATCCTGTCTGTGAAATTAGTGCTAGCAAGATCATCGTAGATCCCCACGTATAAATCAGTAACGC
CATCGCAACCTTCTTCAATAAAGTTTCTTACAGGGGCCACATTCAAGCAACCGCATCGGCCCAACCTGATCATGCAATTAGCAAGCAACACTGTGTACGG
TACAAACAGAAACGACACATATTTCACGTCGCCCTTAGACGCCAGTGCTATCAAGGGGAGATGAAATAACTCCGTCTTACCATAGCCCGGTGGGGCCTGT
ACTGCCACAGAGGGTGTGTCTGCCATGTATATTTCATGACATAAGCGCAACTGATGCAAGTCCCTGAATTCAAAGGAGCTGCCAAAGAGTTTCTGGCCTG
CGACGAGGATATCGTTTGTACTCTTGGGCTCTCGGGGCCTTTTTCGCGTTACTCTTGAAATTTTTTGATCATGATCTGAACTCGCCGCCTCACCTGCCAC
TACGTCTTCCGCATTCCGAGTACTAGAGAATGAACAATGGTAGTCGCTTTCAAGGCCTAACCATTGAATCCAGCGCTCGGAAGTGAGTCCGTCAAGCGTC
TTTAGTCGAGGCTCCGATGAACCGTTCTTGTTGTATCGTCGACGTATACGTTGCGCTGTAGCTCTGGATAACGGTAAGCGTATCACCGTAAGCTCGTCAA
TTATTTTTGAGAGCCGCGGTCATTTTGTTAGTATCTCTTCTCAACTTGGGCAGCACACATGCAAAACATCACCCAATCGGTCCTTTTTGTTCATCATATC
GTTACATATCTGTGAAAAGTACTTTATCTCAATGGGTTTACGTGGGCATAGATCACGCTTCAGCCGCTCTGTGTCGACTTTCTTTTCGCCAGGTAAACTT
GCTTGGTATGCAGAAAAAATCGATAGCTCATCTACGTGTAGTAACAAAAACATGTGGGGTGCCAAATTGTACCCATATCTCCTTATGGTGCTTTTCTGAA
GACTCCTTACAATAGGTGCGCCAGAAACAAAGTCAGTGAAAGTACGCATCGTAGAGCTGTCGTTCGGCCTGGCACTCGCTATTTCGTGACAACGTTCCAG
GACACGGAAACTCAACTCATTATAGTATCCTCTGTTGAGGTAAAAAAGAGAAAGGGTATCGTAATCCTTTCTATTGAATTTCAAAGTATGCACTTGAAAC
AACGTGTAGACCATCAAGTTGATTTTCTTGGGAATAAGATACTTTGAAGGGATTGGTCCGCCCTGGAAATCTGGTTCGTCTTCAACAAACGTCAGGAACT
TTTGTACATTTTTCCCGACCATGACGGAAACGACAATTTTTTCAAAAGACCTTTTCCTATCCATTGCACCAGTTCTGAATTTTACCACTTTGATTAGGCC
AGACTTTTCGTCTTCGTAGAATGACCGCACTTCCGTGGGGATCGATTCAAATAAAGTTATTGAGGGACAATGTACCAAGTCGTTTTTGTTATTTAGAGCC
GACTCAAACTCGTCAAAGTTTGCTTTTTCAAACTTACGCCTATCGGAAACTTTCATTTTATTTTTGTAAGTTTCGAAATTAACAATAGTATGTTGATTGT
TATGCTTTTTGACAAGAAATCCATCAATATAAACAAAAGATTGTCCAGTTTCCGTCTTATCATCATCTAAGAATGTAATAATTAAGCTACTCTATTGAGA
AGAAGCAGAATCTGCGCTATGCAGGTGCAAATCTCCAGCAGCAGCAAAGAAAATTCAGTTAATAAGAAATCTCACTAAGATAAGCGACTGTCTGTCCCAA
CATAGAAAACAGAAGGATGTCTCATTCATCCTTGATTTCCGGCCTGCAAAAATAAAGTAGTCGGTACGTACGTTCGTTTTCAATTTCCATGGTGCACAGT
ATCTTAACTATCTGCTTAGTCGAGGAGAACCAGGATTCTGTTCGTTGCTCAGCCGCTTCGTGGATATTCTCTTGGATACTTTAAATATGGACCTACGCTT
AGCCTGCGCTTAGCCTACAACTTCTTCCGCTCTCGAAAAGACCAATATAATAGAAAGTTATAAATTACATTTCCTTATTAGGTATACGACCTCGCGCTTC
GAAGTAGAGGAGCCCTTTTTGGCGTACCTACATATGGCGCGTCAGACAGACAAACTTCCCCCAAAAATGTATTACCCTGCCGAATAAGAAAACAGACCCA
TTCACCCACGACGTATCAAGTTACTTCCTTGGTGCAATGTCCCACTATAAAAAAATTCCTTGACGCTAGATCGTTGGACTAAAATCTGCGTCACAATCGC
CTAAACAGGAAATATTGCCTATTTTCGTACAAGGTTACTTCCTAGATGCTATATGTCCCTACGGCCTTGTCTAACANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

820,451bp truncated ...