Sign In

GLBRC Y22-3 ( GCA_001634645.1 ) - CM004296.1
Saccharomyces cerevisiae strain GLBRCY22-3 chromosome III, whole genome shotgun sequence

>CM004296.1 Saccharomyces cerevisiae strain GLBRCY22-3 chromosome III, whole genome shotgun sequence
CACACCCACACACACACCCACACACACCACACCCACACCCACACCCACACCCACACACCACACCCACACCACACCCACACCCACACACCACACCCACACC
ACACACCACACCCACACCACACCCACACCCACACCACACCCACACACCACACCACACCACACCCACACCCACACCCACACCACACCCACACCACACCACA
CCCACACCACACCACACCCACACCACACCCCACACCCACACCACACCCACACCCACACCCACACCCACACACCACACCCACACCACACCACACCCACACA
CCACACCCACACCCACCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCACACCACACCCACACACCCACACCCACACCACACCCACACACACCACACCCACACCACACCCACACACCACACCCACAC
ACCACACCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCACACCACACCCACACACCACACCCACACCCACACCCACACCCACACACCACACC
CACACCACACCCACACCACACCCACACACCCACACCCACACCCACACCCACACACCCACATCCGCACCATCCTAACACAACCCTGACCAACCTGTCTCAC
AACTTACCCTCCATTACCCTACCTCGCCACTCGTTACCCTGTCCCCTTCAACCATACCGCTCCAACCACCATCCATCTCTCTACTTACTACCACTCACTC
ACCGTCCACCATAACCGTTACCCTCCATTTACCCATATCCAACTCCACTACCACTCCCCTGCCAATACCCTACCATCCACCATGTCCTACTCACCATACT
GTTCTTCTACCCACCATATTGAAACGTTAACAAATGATCGTAAATAATACATATATACTTACCCTACCACCACCACCACCACATGCCATACCCACCTTCA
CTTGTATACCGATATGGCATACGCACACGGATGCTACAGAATATACCATCTCAACTTACCCTACTCACATATTCCACTCCATGGCCCATCTCTCACTAAA
TCAGTACAAACGCACTCACATCATTATGCACGGCACTTGCCTCAGCGGTCTATACCCTGTGCTATTTACCCATAAATCCCATGATTATCCACATTTTAAT
ATCTATATCTCATTCGGTGATTCCAAATATTGTATAACTGCCCTTAATACATACGTTATACCACTTTTTCACCATATACTAACCACTTAATTTATATACA
CTTATGTCAATATTACAGAAAAATCACCACTAAAATCACCTAAACATAAAAATATTTTACCTTTCAACTTTACGAAATAAACACTTTGACTAGAAGTATG
AGCACTACCATGACGTCATTAATGTAAAAGTTCCTTAATATTGCTATTTTCTTGAACGGATGACATTTCATGTTGAATGTGGTAACCCAATAGCATGATA
TGAGTAATGTTTTAGTATTGTTTCAGAGTTGTTTCAGTAATGTTTAGACAAAGAAAACATATAGTAGCAAACCTCTATTCCGGTAGTACTTAAGGAACCA
TAGTTTCTATGTGCAAAAGCATTACCTATGTAATTCTTACATTTACATAACGTATAGAAGTTCCAATAAACTTACTACATTATGACATATAAGCAAGATC
GTAATTCATTACGTCAACAGGTTATGAGCCCTCAGAGCAATGCTTCTGAGAACATAATCAATCTATCTAGCCCCAGTGGCTGTACGGTATCGAGACCGCT
GCTGAATATTCTAACAAATATATGAACGAATTCGTTCATACCGGAGATATCCAATCAATGAAAAGGGATTACAATCTCAGCGCGAATGATGAAAGCTTTG
TCAAAACCGTATTTAACAGTTTCCTGGTAAAGCTCTACAAGAAAACTATCGTGGGTGAAGCTGCATGTGAAATGAACTGGATATGTGATGATTCGCTTGG
AAGGGTCTCTGCTTATGATATTTTCTCGTACTTCGAAGAAAACTATAATGAAGTCACTATTGGATCCAGGCTTACTCTTATAGAGGACCTACCAAATATA
TCCTCCAAGCCTGTAGATGAAATTGCCTCCTTTCTGAAAACACTATTCACGATGCTTGAAGACAATAGCGAAGAACAGGACAAAAAAAAAAGACGCGACA
CCAATATCGCGTTGTTATTAATGACCTTCTTACCCGAGTTAAAAGAATCATTCCACGAGAAATTCGGTGACTCTAAGGCTCTTCAGCTATCACAAGTCAT
TAGATTCTGTAAATTAAAGGCGTCATCGAATTCATCATCTTCGGTCTCAGATGAATTGGTTGCACAAGACAGAAAAAGCTATCAAAAGAAAGGAAATAAG
GGATGTATAATTTGCGGAGCTGATCATCGCTTAAGCAACTGTTCTCTGCTTGAACGAAGAATACCAGAAGCAAGAATCTTTAAATTACATCCTAATGACA
AGACGAGTAGATCTTCATCTGCTAGTGTTGCGATTCCTGACTATGAAACGCAAGGCCAAACAGCAGGACAGATAACACCGAAGTCCTGACTCTGTATGTT
TTCTTCGACTGTTCCAGCTACCAAATCCTCAGAATGTATTTTTGACACAGGATGTACTTCCCACATGTGCCACGACCGTTCCATGTTTTCATCATTGACT
AGATCCTCTAGGAAAGACTTTGTGAGAGGAGTTGGCGGTTCCATACCCATCATGGGCTCCGGAACTGCAAACATTGGCACTGTTCAATTACATGACGTAT
CTTACGTCCCTGATTTACCAGTTAACCTAATATCCGTTTGGAAACTATGCACTAAATCAAACTCTTCTGTTACGTTCACAAAAGAGGGTGTCACTGTGCG
ATCACCTGATGATGTGGTTTCTACAGCTGGGTATTCACAATAAAAGACTCTGGGAAGTACAAAGCTCGCCTTGTCGCCCGAGGACATACTCAAAAGGCTG
GTATCGACTATCAAGAAACCTTTGCACCAGTCATTCGATATGACTCTGTTAGATTATTTCTGGCCCTTGCTAGCTACCTCAAACTAATAGTATATCAGAT
GGACGTTGACACTGCGTTTCTAAACTCAACCATGGATGAGCCGGTCTACGTAAAACAACCACCCGGGTTTGTTAACGAGAGGAATCCCGACTATGTATGG
GAACTATACGGCGGTATGTATGGACTCAAACAAGCCCCATTACTATGGAACGAACATATCAACAATACTCTTAAAAAGATTGGTTTCTGTCGACATGAAG
GCGAACATGGCTTATATTTTTGTTTCACATCTGATGGTCCCATCTACATTGCCTTATACGTAGACGACTTACTTGTTGCTGCTCCCTCTCCTAAAATATA
TGACAGGGTTAAGCAAGAATTAACGAAATTATACTCAATGAAGGATCTCGGTAAAGTTGACAAATTCCTCGGTATTAACATTCATCAATCGTCAAACGGA
GACATCACTCTCTCCTTTCAAGACTATATTGCTAAAGCTGCATCTGAAGGCGATGTAAACATATGTAAACTTACACAGACTCCGCTCTGCGACTCAAAGC
CTCTTTTCGAAACATCTTCCCCGCATCTAAAGGACATCACTCCTTATCAGAGCATAGTTGGTCAGCTCCTCTTTTGTGCAAATACTGGTCGTCCGGACAT
ATCGTATCCAGTCTCATTACTCTCCAGGTTCCTTCGAGAACCTCGCGCAATCCATTTGGAGTTTGCTCGGCGGGTTCTACGGTACCTATATACCACCAGA
AGTATGTGTCTCAAGTATCGTTCTGGATCTCAGTTGGCATTGACTGTATATTGTGATGCATCTCATGGAGCAATTCACGATCTACCACACTCTACTGGGG
GGTACGTGACTCTACTTGCTGGTGCTCCCGTTACGTGGTCATCAAAGAAGCTCAAGGGTGTGATTCCTGTACCATCTACTAGGCAGAATACATTACTGCA
AGTGAAACTGTCATGGAGATATAATGGATTCAAAACTTGTTTGAACACTTAGGCCAGCCACTTATCTCATCAGCATCATATGTAGATAATAAACCTGCTA
TAAAACTGTCTAAACATTCTGTATTTCACACGAAAGCAAAACACATTGCTTTGGGATACCACAAGCTAAGAAATGCAGTGGCAGCAGGCATAATTACCAT
AGAACATGTTATTATAAAGAAACAAGTTGCTGACATATTTACAAAATCCTTCCAGCTGAATCATTTAAAACACATAGGGCTGTCATGATAAGGGAACCAG
AAACTACAAAATAACCATACTCATGCGTATTCAGTTATGGGGGGATGTTGAAACTAATAACCCAAAAAGCATGATATGAGTAATGTTTTAGTATTATTTC
AGTATTTATTCAGTAATGTTTACACAAGGAAAAAATATAATAGCAAACCTCTAATCCGATAGTACTTAATAAACTATACTTTCTGTGTACAAAACACTAA
CTATGTAATATTTTTTTTACATAACATGTAGAAGGCTCCAATAAACTTACTATATTATGACATATAAGTTAGATCGTAATTCACTACGTCAACATATCCC
ACGATAAAAAAAATACCTTGACGCATGTGCCTAAACAGGAAACAATGAAAGATTTCATACAAGGTTATTTCTAAGGTGCTATATGTCCCTACGGCCTTGT
CTATCCCTATCCCGCATGCAATACCGTAACATAGGTATATACACACACAGAAGTAGTAATCCTACGTGTCTTATACTTATTTTATATAGAAATGTCCGAC
ACTTGCGCTACACTAAGGCATATAAGATAGATCTTAATTCCTTGTATCAACATATAAGCAGACAGCATAACATAGCCAGTTTATCTTACTTATCTTTTAC
TGAAAGAGATGGCATTATTTGTGTGTATCACAGAGGCCTTTTTCAATTTTCATTTTAATATTTTTTTCAATATTCTTATATTGAACACATTTTTCTCGCA
TAAATTTAATTATTGCTCTCCATATCACATTATATCTATGAATGAATATGCATTGCTCTTCTGATACTATGGTATGAGAGGCCTTGGTAAAGGGCATCGA
TAACCGAAAGAATCATCCGCAGAGAACTAGAATCTTAGAGCATATCGTCTCGTTGAGACCGTATAGATTCGCAAAAATAACAGAAACTTGCGCTAACATT
GAATTTCAAACTCAGTTTTCCATAATTAACTGTTAAAAAAGGCTACTATAAGGGTGTCAATTACTGTTCTGTTTCGCAGGATTAATTCCGTTATGTGCTC
TTGTAATTGAGTTAGCGCTTCTTATATCTCTTCAGTAATGCAGCAGTAATAAAACACATTTGCTTCGCTTTCGCTTTTTTTCCAAATCATTATCGAAGAT
TCTTTGCTTATGATATACTGGTGCTCGAGGATGATGAGAGGACACAACTTTTTGAGGCTTATCGTTATCGTCTGGGTCACAACAACATACATTAACTGTC
CACGATTCAGGGATGTGCTATGAGTTCAATTTTCGCTGTAGTGCAGCCATTGGCGCTGCTACTGGTGTCTGGAAAAACTCCACAGCTTTCAATGGAGATG
TGACTGCACGAGTGAGACATTATCTGTATTAGCTTCACAACCATACTCTGTTAGTAAGGAGCCATAGTCGACATCTGTCAACAATCCTAGGAGTTCCAGC
TCAATCGGGTATGATATCATCTCTGATACCCCCAAAATACATGGCTGTACCATTTAAAATAAGTGGTATATTGAAGAACAGTATATTTCAGCCTATACAG
GATCCTACTCTTTCAACAAAAATGATTTCATCAAAATTAAATCACGCTGCAACATTGGTGAAGAATCTCAAAAGGTTAGCAACATCAATATATCGCGGAG
TAGCTATCATTGTGGCAGCTAACTTAAAGGATATACAGTTAATTCAACAAGATTTTCAAGTCCATTTCTTTTGAGCACGCTGAACACGCTCAATGTAGTA
CTTGTTTTGGAAATCACTCGCAAGTTTAATGGGACGAATTATATCAGTAATGTGTAAATTCCGACACAATGTTCGGTTAGTAGATTTACTGCTGGATTAT
TGGGTTCACCCGTAGACCGTTGCCGACTCCAAGAAAACTATGGTCTCAATACAGGCATAAAGAATTGTTGTATCTGTGCCCATGTGATCTGTATCTTTTT
TGCGGTATCAAAATCGCATGTTGCACTCACACTACGGAACACATCAACTAGTAACGACAACAATGCAAAATACCAGGAGACATATCACTTTTTTTTCGCT
TAGAATGATTTACAATGGCATACACTTAGAAAAGCGCTATCACATGACGCCCTTACTAGAAGTTACATGATTCTCTTTTTTTTCCTTTCTTTCTTTCTTT
TTCGGTACAACATAATTAATGCATTCATACAGAGCGCATTTCCAGCACCATTTATTGGATAGTAACTCCTCCCGCACTTTTAATATCAATGACGCTGACT
CTTTTACTGACGCTGATTCTTTACCGACGCTGAGTCTTTACCGACGCTGAGTTTTTACCGACGCTTGTGAAAATAAAAAGTACGACACAGCTATATGCGT
AGCAAGTTCAAATGTGGGTTTATCGAGCATGTTTATCCTATCCTGTTATGTCATTTTTATCGAAAGTAATAAAAATGTAGAAATCACTTGTTATTGCCTT
TTTTGTGATTTTGCTTTCTTTTTTTTTTTTTTTTTCCCTTTTTTCACCAGCTTGAGGATCAACATCCTGATTCCTTGTCACTTCGATTATGTTTAAAAAG
TGCCTTGATTTGAGAGAAAATGTTTTCCTCATCTGGCAAGACGACCAAACCATCTTCAGTGAATTCTTCGTGTGTCGCCTTGTCTATTAGTTCCGGATCT
CTCATGAACATTGTAAACGCAAAGAACGGTACCTTACATGCCAAGCCAACCGTCATTATTATTCGTTGAACATATCTGTAAGATTCAACCACAGCATCTC
TTTCGGGTGAGCCCCAAGGATAATCATTAATGAATGTATAAGGTGATGCATATGCTATTTCTGCCAATGTATCGTTTCCAAGGTTCTTGTAGAGTTGGTT
GGGCATGGTTTGTGTCCATATGGCACCAGAAACGGAGGCACCAATAGCAGCGCCTAGCTTCGAAAAGGTATATTGGATGCCGGTTATTACAGCCATCCTA
CTATGCGTAGTCATGGCTTGCAGTATGACGATCACTGAATTGCTGCATAGGAGACCGCTCAAACCCATGATAACAGATGCAGCTATAACACCTTCATGAG
ACCCGGATCCTCCTCTGTATTTGTAAAAAAGGCCCATGCACACCATCCATGCAGCACAACCTCCGATTACAGAAAGTTTCAGTTTCCTCGTCTTTGCCAC
CAACAAACTGTAGAATGGAGATGCAGTAGCAGCAACAAAGTCAGGAAGGTTTACTATCCGAGCAGCCGAAGTGGACGATTCTTTCATCGATACCAGCAAA
ACAGGATACAGATAGTCACACGAAATGAAAAAGGTGAAAAAATTGAAAAAAGTAACACCAAGGGGTGCCCAAATTCCACGATCACTTAGTAATTTGAACG
GTAGAAGAGGAGATTTGGCAAATTTGGCCTCCCAATATAAAAAATGAAAAATAAACAGCCACCTGAAACTAAAGTGGCAATTATTTTTGAATTGTGCCAC
TTTTGTGATGTCTCATTAGCCAACGTCAAAGGAACAAGAATACACCCTAGCGACACAGTTATTAATAATATGCCAACAATATCGAGTTTCCAGAATAGAA
ACACCAAATTCTCAAATAATCCGCCCGTTCTTTCCTTTCTAGCCTGTTCTTTGAGAGATCTCCACTCAGCAGTCTTTGAAGATTTGTACTTCATATAAAG
AATAAGAAATATAATTGGCAAGGCAGAGAGTGGGTAAATAAAAGCCCACATTGCAATATTCCAGGACCAGTTTTTCTGAGGATTTGCTGCTGTGATAATA
TTACCTGAAATCCATGGTATTATGATATATGGCCAATATGAGGCGTACTGGTAAAACATTCTCCATTTCAAGGAGGAGAAATCAGAAAGTATTAATGTCA
GGAGCAGATTTGTTCCGACGTATCCACAGTTATAGAAAACCGATCCTGCTGCATACATTGTGAGACGGGTCGCCTGTGATTGAATGATGGTTCCCATTAT
ATAAAAAATAGTTGCAACTAAAAAAAGCCTCAGTCTTCCGAAGTGGTCAGAGAGTCTGGAGTAGACAACTTGGGATCCGACACTCACAACAGCATTGATA
ACTTGGACAGTTGAAAGTAAGGAGTGTTCTGAATATGAGTTCGTCGCATAGCCCGTATAGGTCGATCTAAGTGTGTAGTCTAAACTAATTCCAAACCCAC
ATACAAACGCGGTACTTATCAGTAGAATTTTATATTTCAAGGAATCAAACTGTGCAGACATAATTTCGTTTTCTTTGAGCTTAAAAAAGGTCGATGTCAT
AGAGTACGTGTCATCGTTTGAGTGACGTTCTCGCTCAATAATCTCACAGGACTGCCTAATTCCACTTTTTTTATTACTTGAGGCACCAACAACACTAGAA
CTCATCCGATAATTTATTTACTTGATTATTCTTTTTTTTTTTTTTTTTCTCTTTCCAGTCCATAAAACTATTTTACTTTTCTTATTTATGTAAATAGTAT
TTAAGATTCTACGGTCGCTACATCTGCTAGAAATGGAATTACTTTAATACATTCCATGTTCTCATATATACTTTTACTGACACCTTTCGTCACTATTTTT
TGTTTAACCTTTTTTTTGGAAGCACTAAAATTATATGCTCGTAATTATTGAGCATCAAAAAAAATAAAAAAAATTGCTGTGACACCCCTTCAATGTGGTG
TCTATACACCTGGTGACTTTAACTTTAACTTTGACCTGTCGTCGTACAATCAACTTAGTTTCTGAAAATCCACAACGAACCAGTTATACCGAAGACTTTT
GTACGACAAGAATACTGTACTGTCGAAACTATCTCTTTTCAAACTGATGAGCGAAGCTTGTGTTTATGTCTGTTGAAACAAGGAAAAAAATGCGGTGCCT
GTCGACAGGATATGCGCACAAGTGCAAAATCATCAAAAAATTGAGTACCTAGATCCGGTGGTGTAGGGCGAGCAAAGTTCCTTCATAAACAAACCGTAAG
GGTTACTGATACACAATTTCCTTTGTGTAAAGAGTATTTGAGCAAATTAGTCAGCGATTGAAAACAACACCCTTTTTTCTATATATAGTAGGTGAAAGTT
AACATGCGAGTAAAAGTAGTGCCACATTTCCTTTGCAGCAGGTGCAAATTGGTACATATTTAACAGATAGCGCCGCACCTCATATGCAGCGCGTACATGA
TACGAGACGACAAGATATGCAAAAGATAATAGTGTCATCACACCTTTATGAGAAGCGAATTTTTTTTTTTTTTTTTGGTTTAAATATATATATACATATA
TATAGATATAGATATACACATGTATAGATGTATTCTAGTTATACTTATACCTAGAACTGATCAGACCAGATCATACCTGGTATAGAGCTTAATCGATAGA
AATTCAAAAATATGGAGGAAACTAAGTACTCTTCGCAGCAGGAGATAGAAGAAGCATGTGGTTCAGACGTTTCATTGAATGCTAGAGGTAGCAATGATTC
TCCAATGGGACTTTCCTTGTACCTCTGCCTGGCTTCGTTAACTCTTGTACTATTCATAACTGCACTGGATATTTTGATAGTGGGAACTATTATTGACGTG
GTCGCAGAACAGTTCGGAAACTACTCCAAAACAGGTTGGCTCGTTACAGGCTACAGTTTACCAAATGCTATTCTGAGTCTCATTTGGGGAAGATTCGCAT
CTATCATAGGTTTCCAGCATAGTCTCATTTTAGCAATACTTATTTTTGAAGCCGGATCCCTAATTGCTGCCCTTGCCTCTTCAATGAATATGCTCATTGT

310,888bp truncated ...