Sign In

GLBRC Y22-3 ( GCA_001634645.1 ) - CM004297.1
Saccharomyces cerevisiae strain GLBRCY22-3 chromosome IV, whole genome shotgun sequence

>CM004297.1 Saccharomyces cerevisiae strain GLBRCY22-3 chromosome IV, whole genome shotgun sequence
CTACCTCTACTCTCGCTGTCACTTCCTTACCCGGCTTTCTGACCGAAATTAAAAAAAAAAAATGAAAATGAAACCCTGTTCTTTAGCCCTACAACACTTC
TACATAGCCCTAAATAGCCCTAAATAGCCCTCATGTACGTCTCCTCCAAGCCCTGTTGTCTCTTACCCGGATGTTCAACCAAAAGCTACTTACTACCTTT
ATTTTATGTTTACTTTTTATAGATTGTCTTTTTATCCTACTCTTTCCCACTTGTCTCTCGCTACTGCCGTGCAACAAACACTAAATCAAAACAGTGAAAT
ACTACTACATCAAAACGCATATTCCCTAGAAAAAAAAATTTCTTACAATATACTATACTACACAATACATAATCACTGACTTTCGTAACAACAATTTCCT
TCACTCTCCAACTTCTCTGCTCGAATCTCTACATAGTAATATTATATCAAATCTACCGTCTGGAACATCATCGCTATCCAGCTCTTTGTGAACCGCTACC
ATCAGCATGTACAGCGGTACCCTCGTGTTATCTGCAGCGAGAACTTCAACGTTTGCCAAATCAAGCCAATGTGGTAACAACCACACCTCCGAAATCTGCT
CCAAAAGATATTCCAGTTTCTGCCGAAATGTTTTATTGTAGAACAGCCCTATCAGCATCGACAGGAATGCCGTCCAATGCGGCACTTTAGATGGGGTAAC
TCCCAGCGCAAGCTGATCTCGCAAGTGCATTCCTAGACTTAATTCATATCTGCTCCTCAACTGTCGATGATGCCTGCTAAACTGCAGCTTGACGTACTGC
GGACCCTGCAGTCCAGCGCTCGTCATGGAACGCAAACGCTGAAAAACTCCAACTTTCTCGAGCGCTTCCACAAAGACCGTATCGTCTTTTGCCTCCCATT
CTTCCCGGCACTTTTTTTCGTCCCAGTTCAAAAAGTACTGCAGCACCTCTGTCTTCGATTCACGCAAGTTGCTCCATACTTTATAATACAACTCTTTGAT
CTGCCTTCCAGACATGCGGAAAACTTGGCTCCCTTGCTTGCCTCTTGTCGAATCCAATACACTAATTGTTTCTCTTCTTCTAGTAATGGCCAGGTACCAA
GCATAATTTCTCTGTATCTGAGAGTAGATCTCTCTCCTTTTTACGCTAAAAAATTTCAAATATCCTACAGGGTCCCCATGATATGGCTCGATGTCTTCCA
AGTATTCTTTGTATTCCTCGTCATTTCGCAGCATTCTCTCCACAGCTAGTGCTTCCCAAGCCATCCTCCGATACGATACTTTCTGGCCAGCCCAACAGAC
ACAGAGCTCGAACATCTTTTGACAGCCCTTGCATAATCCGTATTGTGTGAATACTCCCTCTGGGCAGAAGTATACGTCAATACCATAGAGGAAAAGATGT
TTAATTTCGTCAGACCGAAATCCAAGAAACTGTAAGACATTCATATTCTCGGAAGTATTGGGAAATTGTGCTTTCAGTTTCTTTCTCTCTAGCAAAACCA
TTTGACTCCCTTTCCGCTTATACGACTCTTTGTTAATGTCGGTGACTGGATGGAATCTATTATCCTCAGCATTGCCATCTTTATTGGCGTCCTCCTTGGC
ACTAGCGTTGGTACTTTCAGTGGTAGTGGCATTAGTGCTGGAGTTGGTACTTTCAGTGGTAGTGGCATTAGTGCTGGAGTTGGTGCTAGCAGTGGTAGTA
GCACTAGTGTTGGAGTCGGTACTTTCGGTGGTAGTAGCACTAGTGTTGGAGTCGGTACTTTCGGTGGTAGTAGCACTAGTGTTGGAGTTGGTACTTTCAG
TGGTAGTCGCACTAGTCCTGACGTTGATGCTGGCAGTGGTAGTAGCACTAGTCCTGACGTTGGTGCTGGCAGTGGTAGTAGCATTAGTGCTGGAGTTGGT
ACTTTCAGTGGTAGTCGCACTAGTCCTGACGTTGATGCTGGCAGTGGTAGTAGCACTAGTCCTGACGTTGGTGCTGGCAGTGGTAGTAGCATTAGTGCTG
GAGTTGGTAGTCGCATTGGTACTGGCATTAGCACTACCATGAATGCACGTGTCGCTGTCCTCATCACTGCTGCAATACTTTCTGCACCTGTCACTGCTAT
TGCTCTCCTGGAAGCTAGACGGTAACGCAACGATCGACATGGAAGCTGTCGCCTGTTTTTCAGCCAATCTGTCCATTCTTTCTATCAGTTCCACTGTGTC
AGCAGACAGGTCTGTCCTGGAGCCACAGCATCCAACATGCTGGCCCTTTTTTCCTTTCTTTGATTCAAGTCCATAGAACTCGCGTACCTGTTCGGTTATA
CAGCCTTCCTTAATTGGTGGTAATTCACCCTTACGATTCCTTGCCGCCCAACTGTTTTTTCTAGATAATAGATAACAGAGGCCCCCATCTCTTAGTCTCC
CTACGCCTTGAATGAGCTCAATAATATTAAGTCTATTATCAAGCATGATCACCATCATCAATTGCTTAATGTCAATTCCTTCAGTCACTAATTTCGTTCC
GATGAGAACTCGCATGCTACCGTCAGTGACAAACTCCTTTGTGCGAGACACCTTTTCTGCAGCACCCAGCTTCCCGTGTATCCATACCACCCTAAAATAC
TTTCTCCAAGAGCAGGCCAATTCTTCCACTTCGTTGGTTGTGCTTGCAACTACAATGGCCTTCGACTCTGGTTCAATTTCAAAGAGGGCTAAAAGAAGCT
TCAGTGCTTCTTCGGGCTGTGATTCCACTTTCTTCCAAATTTTATGAACATGCCCTAAAGGCACCTCGGATTTCTCCTTGATTAGATTAAACATCCGTGT
TGGATAGCTGGATAGACCTCTGCTGAGATCTTCCGACCGTTTGAGCTCGTTGATGTCCATCGACTTCTTGGCCAGTCCCGTAAGCCCAATACGCTGCAAC
GCAGCATCAGCTACAGCCTCAGGTGCTGTGCCGCTCAAAAAGATTGCTTTCTCAAAAGCGTCAAAATCAAGGTTAGTTATGCCCCCAAATTGCGACTGCC
GGTAGACCTCCGTTTCAAAGTTGTGAAACTCATCTACAATGAGGTAACCCAATTTTACGTTGTTGGTCCTAAAGGTGCACTCAACAATATTCTCCCACGC
AGCTATCCTGTCTGTGAAATTAGTGCTAGCAAGATCATCGTAGATCCCCACGTATAAATCAGTAACGCCATCGCAACCTTCTTCAATAAAGTTTCTTACA
GGGGCCACATTCAAGCAACCGCATCGGCTCAACCTGATCATGCAATTAGCAAGCAACACTGTGTACGGTACAAACAGAAACGACACATATTTCACGTCGC
CCTTAGACGCCAGTGCTATCAAGGGGAGATGAAATAACTCCGTCTTACCATAGCCCGGTGGGGCCTGTACTGCCACAGAGGGTGTGTCTGCCATGTATAT
TTCATGACATAAGCGCAACTGATACAAGTCCCTGAATTCAAAGGAGCTGCCAAAGAGTTTCCGGCCTGCGACGAGGATATCGTTTGTACTCTTGGGCTCT
CGGGCCTTTTTCGCGTTACTCTTGAAATTTTTTGATGATGATCTGAACTCGCCGCCTCACCTGCCACTACGTCTTCCGCATTCCGAGTACTAGAGAATGA
ACAATGGTAGTCGCTTTCAAGGCCTAACCATTGAATCCAGCGCTCGGAAGCTCGTTCCTGCAATAAAGTGGCGGTCGTCCCACTGACACTAGTTAACGAA
AAGGAATCCACACCGTAAATATTTCGCCCTGTTTGAACGGAATGATTGGCCATGAGTTCACTCGTCGCCGACTCGTACAAATCTGTTTCAAATCTGCTAC
CTACGCAGTGCCGTCCTAGGGCAATCAACCCCTGACGCATCTCCCGAAAATTCAGCTTCTGAGGTGCATTCTTCGGAAGTTCCCTCATGTACTGCCGAAA
AGTTGCGTATTCAACCAGACAGCCCTTCGCGGTATTCAGAAACATGTAGGAATACAAAACTATCCTCGAAATGTCTCGATTTGTTACTTGATCTGGATCC
TCAAATCCCACCACATCCATCCAAGGATCATGATTAAAAGCGTCATAACTGTTACCAAGCGCACATATTTGCATTTGCCTTAGCACAGTGACAAAATAAA
ACACGTAATCTGAAGTGAGTCCGTCAAGCGTCTTAAGTCGAGGCTCCGATGAACCGTTCTTGTTGTAATCAGTGTACAGTTGGATGCGTCTTGTTGTATC
ATCGACGTATACGTTGCGCTGAGGACCGGCAAAAGCGAGTAGCTGAAGCTCTGGATAACGGTAAGGGTATCCTACGGCAAAATGGACCATCCACATAAGT
GGCACCGTAAGCTCGTCAATTGCAACAGTGACTTTATTTTTAAGAGCCGCGGTCATTTTGTTAGTATCTCTTCTCAACTTGGGCAGCACAATTTCACGAT
ATTTAACAGGTATCATTTGAAGAAAAGAATCGTTTTCCAGATACTCGTCAATTCCTCGCTTTGGCTCTCTGAACAAAACTTCTCGATTACGCAAAATGAG
GCTGGCAATATCAACCACTGTAGGCATATAAAAGCAGTTGTTCAACTCTCCCCAAAGGTTATCGAACTGAGCCTTGCATGCAAAGTAAAAGCCGCGGACA
TACTCGCGATTAAAAAGTTTTCCACATACTGATATACCATCAGAAGAAGGTACCAAAGTTATTCTATAAGAGTCCTTCAGCGTGGTTTCCTGCGCTACTT
CGTGGTACAGAATTTTGATCCATTTCCACATTGCAACGCCGTTGGTGTCATCAAATATATCTAAATCCCTTGCAGTACAAGCACAAGACGACACCAATAA
AGCTTTCACGGCATCTAGTGTTTTTCTGAGTCTTCGTGGAGTGTTAGGACTACGCAACTTACATACTTTCAAGCCATGCTCGTCCACAGAGGGAATAATG
GGTTCTTCATTCGTAATAGATCGATCCTCTTCGTCACCAGCGCCACCACGGGGACCCGCCCCGAAATTGAGCGCACATGCTCGCAAGATAATATGCAAAA
TATCACCCAATCGGTCTTTTTTGTTCATCATATCGTTACATATCTGTGAAAAGTACTTTATCTCAATGGGTTTACGTGGGCATAGATCACGCTTCAGCCG
CTCTGTGTCGACTTTCTTTTCGCCAGGTAAACTTGCTTGGTATGCAGAAAAAATCGATAGCTCATCTACGTGTAGTAACAAGAACATGTAGGGTGCCAAA
TTGTACCCATATTTCCTTATGGTGCTTTTCTGAAGACTCCTTACAATAGGTGCGCCAGAAACAAAGTCAGTGAAAGTACGCATCGTAGAGCTGTCGTTCG
GCCTGGCACTCGCTATTTCGTGACAACGTTCCAGGACACGGAAACTCAACTCATTATAGTATCCTCTGTTGAGGTAAAAAAGAGAAAGGGTATCGTAATC
CTTTCTATTGAATTTCAAAGTATGCACTTGAAACAACGTGTAGACCATCAAGTTGATTTTCTTGGGAATAAGATACTTTGAAGGGATTGGTCCGCCCTGG
AAATCTGGTTCGTCTTCAACAAATGTCAGGAACTTTTGTACATTTTTCCCGACCATGACGGAAATGACAATTTTTTCAAAAGACCTTTTCCTATCCATTG
CACCAGTTCTGAATTTTACCACTTTGATTAGGCCAGACTTTTCGTCTTCGTAGAATGACCGCACTTCCGTGGGGATCGATTCAAATAAAGTTATTGAGGG
ACAATGTACCAAGTCGTTTTTGTTATTTAGAGCCGACTCAAACTCGTCAAAGTTTGCTTTTTCAAACTTACGCCTATCGGAAACTTTCATTTTATTTTTG
TAAGTTTCGAAATTAACAATAGTATGTTGATTGTTATGCTTTTTGACAAGAAATCCATCAATATAAACAAAAGATTGTCCAGTTTCCGTCTTATCATCAT
CTAAGAATGTAATAATTAAGCTATTGAGAAGATGCAGAATCTGCGCTATGCAGGTGCAAATCTCTAGCAGCAGCAAAGTAAATTCAGTTAGTAAGAAATC
TCACTAAGATAAGCGACTGTCTGTCCCCTTCAAGCACAACATAGAAAGCAGAAGGATGTCTCATTCATCGCTTGATTTCCGGCCTGCAAAAATAAAGTAG
TCGGTACGTACGTTCGTTTTCAATTTCCATGGTGCACAGTATCTTAACTATCTGCTTAGTCGAGGAGAACCAGGATTCTGTTCGTTGCTCAGCCGCTTCG
TGGATATTCTCTTGGATACTTTAAATATGGACCTACGCTTAGCCTGCGCTTAGCCTACAACTTCTTCCGCTCTCGAAAAGACCAATATAATAGAAAGTTA
TAAATTACATTTCCTTATTAGGTATACGACCTCGCGCTTCGAAGTAGAGGAGCCCTTTTTGGCGTACCTACATATGGCGCGTCAGACAGACAAACTTCCC
CCAAAAATGTATTACCCCGCCGAATAAGAAAACAGACCCATTCACCCACGACGTATCAAGTTACTTCCTTGGTGCAATGTCCCACTATAAAAAAATTCCT
TGACGCTAGATCGTTGGACTAAAATCTGCGTCACAATCGCCTAAACAGGAAATATTGCCTATTTTCGTACAAGGTTACTTCCTAGATGCTATATGTCCCT
ACGGCCTTGTCTAACACCATCCAGCATGCAATACAGTGACATATATATACACCACACCCACACCCACACCCACACACCACACCCACACACCACACCCACA
CCCACACACCACACCCACACCCACACACCACACCACACCCACACACACACCCACACACCACACCCACACCCACACCACACCCACACCACACCCACACCAC
ACCCACACACCACACCCACACACCCACACACACCCACACACCACACCCACACCACACCCACACCACACCCACACCACACCACACCCACACACACCACACC
CACACCCACACACACCACACCCACACACCACACCCACACCCACACACCCACACACCACACACTACCCCTAACACTACCCTATTCTAACCCTGATTTTACC
TGTCTCCAAACCTACCCTCACATTACCCTACCTCCCCACTCGTTACCCTGCCCCACTCAACCATCCACTCCCAACCACCATCCATCTCTCTACTTACCAC
TAACCACCGTCCACCATAACCGTTACCCTCCAATTACCCATATCCAACTCCACTACTACTTACCCTGCCATTACCTTACCATCCACCATGTCCTACTCAC
TGTACTGTTGTTCTACCCTCCATATTGAAACGTTAACAAATAATCGTAAATAATACACATATACTTACCCTACCACTCTAATCCCACCACCACATGCCAT
ACTCACTTGCACTTGTATACTGATATGGCATACGCACACGGATGCTACAGTATATACCACTCTCAAGTTACCCTACTCTCACACTCCACTCCATCACCCA
TCTCTCACCATCAGTACCAAATGCACTCACATCATTATGCACGGCACTTGCCTCAGCGGTCTATACCCTGTGCCATTTACGCATAACTCCCACGATTATC
CACATTTTATTACCTATATCTCATTCGGCGGCCCCAAATATTGTATAACTGCTCTTAATACATACGTTATACCACTTTTACACCGTATACTAACCACTCA
ATTTATATACACTTATGCCAATATTACAAAAAAATCACCACTAAAATCACCTAAACATAAAAATATTCTATTCTTCAACCATAATACATAAACACACTTA
ATTGCGTCTTAATACTATCATGGTATCATTAACTTAAAGTTCCTTAATATCGTCATACCACTATGCTCTATTCCATATATTGTAATATAACTGTACTCTA
TAGTCATACAGACGCTTTTACTTCACCCCATCTTCTCATACTATTGTCATAGAATCTCACACTGACGCATGATTAAAACGAATAATTTTTACTGTAAGGG
CTGCCATCCGCGCTCTATCCTTTTGTTTGCAATATTTATATACAGAATCTCAAAACAAGCGGGAGAAGTGCTAATTACCCAGAGGTCATGCATGATCTGA
GTACCACCGTACCTCTAGGTTTTGCTTTGATCCGTTTTACAGTGACACCGAACATAAGGGGAAGCTATTGACATGGTATCGAAAGGTTGTCCACATTGGG
AAGTAACTTGGTTCTATGAATCTTCATGTCAGATACGTAGGACAGACTCTTTCCTGTGTAAATATTTGTGACAGCTACGTCTATTTTCTACTAGATGTTT
ACACAGTTTTGTCACAGGAAATCTACGCTTAAAATATGTATTTCATTCAAGCGGTAACCGCTGTACGAGCAGTGACATTGCTGGTCGCACCTTAAATGTA
AACCAACGTTACGGCACACCGTGATGTACCCGCATTAAAGTTTTGTAAATTCGTTATTACGATTATTGAATTGGCTAGATAGAAAACAGGAAATGAAATG
GATACCCTTTTCGAATAGCTGAGTTTCTTTGCCTAAAATAGCCCAACATTGTTGCCCTTTTTCTATCACGAGGTTACTGAGCCATTGCATGAACGCGCGC
GCCTCGGCGGCTTTTTTTTCCTGCTGTATAAAAGCGAAAAGCCAGAAGTTACTATCTCGAATAAAAAACCCCTCGAACTGCCATCTCACTACCGAAAATG
AAAGAGAATGAAGTCAAAGATGAGAAAAGCGTAGATGTGTTATCCTTCAAACAGCTCGAATCCCAAAAGATTGTTCTACCTCAAGATCTTTTCAGAAGCA
GCTTTACCTGGTTTTGTTATGAAATTTACAAGTCCTTAGCGTTTCGCATCTGGATGCTATTATGGCTACCACTTAGCGTCTGGTGGAAACTTTCCAACAA
TTGTATTTACCCACTTATAGTTTCACTTCTGGTCCTGTTTCTGGGACCAATATTTGTCCTTGTTATTTGTGGACTTTCTCGTAAGCGTTCCTTATCGAAA
CAACTCATTCAGTTTTGCAAAGAGATTACTGAAAACACACCAAGTTCTGATCCTCATGATTGGGAAGTCGTTGTAGCAAATCTAAATTCGTACTTATATG
AAAATAAGGCTTGGAATACTAAGAATTTCTTTTTCAATGCTACGGATTGTGAGAAAATGTTCAGAACAACTGTTCTTGAACCATTTTCTTTGAAAAAAGA
TAAAGCTGCCAAGGTTAAGTCATTTAAGGATTCTGTCCCTTATATCGAAGAGGCTTTGCAAGTGTATGCTACAGGATTTGACAAACAGTGGAAGTTGTTT
ATTACTGAAAAATCATGGAGCCCTGTTGGCCTGGAAGACGTTCAGCTTCCCAAGGATATTCATCGGTCCAAGCTTACTTGGTTTTTAAAGCGGATTTTCA
CTATTTACTCTCTACCATTATGGCTTGCTTTTTTGAACTGTATCTGCGTGTCACAGCATTTTTGCCTTGCATTTCGTATCTTGTGTCCTGGATTGTTTTT
CCTCATGATGGTGTGGCTTTTCCAAAATATGAGGACGACTGCTTTACTCGTGAAAATGGAACACAAGATGCAATTCTTGTTGACTATTATAAATGAGCAA
GAAAGTGGTGCGAATGGATGGGACGAAATTGCAAGGAAAATGAATAGGTACTTGTTTGAGAAAAAAGCCTGGAAGAATGAAGAGTTTTTCTTCGACGGGA
TTGACTGTGAATGGTTTTTTAGCCACTTCTTCTACCGCCTTCTATCTGCAAAGAAATCTATGTGGCTTTTACCATTGAATGTGGAACTATGGCCATATAT
TAAAGAAGCGCAATTGTCCCGCAATGAAGAGTCTTTAATGAAGAAATGAGAACGCCCTTCTGGACTTAAAAATTCATACTTTTGCATTCTGTTAGATATG
AATACTACACTCTATTGAGTGACTTTAAAAGGCGAGTGGACACTTTTATCAAGCGATTTATCATGCAGTAATACTAATATTACTAATTAATCACTACTAC
CTCTCTTAAACAGGAAATATGCTATTCATCAGTAAGAAGCTGCACAAATGTTATATATCATACCAGGAATACACATAAGAGCAAAAATGCTATTCTACAA

1,550,355bp truncated ...