Sign In

GLBRC Y22-3 ( GCA_001634645.1 ) - CM004298.1
Saccharomyces cerevisiae strain GLBRCY22-3 chromosome V, whole genome shotgun sequence

>CM004298.1 Saccharomyces cerevisiae strain GLBRCY22-3 chromosome V, whole genome shotgun sequence
GTTTGCCAAATCAAGCCAAGTGTGGTAACAACCACACCTCCGAAATCTGCTCCAAAAGATATTCCAGTTTCTGCCGAAATGTTTTATTGCAGAACAGCCC
TATCAGCATCGACAGGAAATGCCGTCCAATGCGGCACTTTAGATGGGGGGTAACTCCCAGCGCAAGCTGATCTCGCAAGTGCATTCCTAGACTTAATTCA
TATCTGCTCCTCAACTGTCGATGATGCCTGCTAAACTGCAGCTTGACGTACTGCGGACCCTGCAGTCCAGCGCTCGTCATGGAACGCAAACGCTGAAAAA
CTCCAACTTTCTCGAGCGCTTCCACAAAGACCGTATCGTCTTTTGCCTCCCATTCTTCCCGGCACTTTTTTTCGTCCCAGTTCAAAAAGTACTGCAGCAC
CTCTGTCTTCGATTCACGCAAGTTGCTCCATACTTTATAATACAACTCTTTGATCTGCCTTCCAGACATGCGGAAAACTTGGCTCCCTTGCTTGCCTCTT
GTCGAATCCAATACACTAATTGTTTCTCTTCTTCTAGTAATGGCCAGGTACCAAGCATAATTTCTCTGTATCTGAGAGTAGATCTCTCTCCTTTTTACGC
TAAAAAATTTCAAATACCCTACAGGGTCCCCATGATATGGCTCGATGTCTTCCAAGTATTCTTTGTATTCCTCGTCATTTCGCAGCATTCTCTCCACAGC
TAGTGCTTCCCAAGCCATCCTCCGATACGATACTTTCTGGCCAGCCCAACAGACACAGAGCTCGAACATCTTTTGACAGCCCTTGCATAATCCGTATTGT
GTGAATACTCCCTCTGGGCAGAAGTATACGTCAATACCATAGAGGAAAAGATGTTTAATTTCGTCAGACCGAAATCCAAGAAACTGTAAGACATTCATAT
TCTCGGAAGTATTGGGAAATTGTGCTTTCAGTTTCTTTCTCTCTAGCAAAACCATTTGACTCCCTTTCCGCTTATACGACTCTTTGTTAATGTCGGTGAC
TGATGGAATCTATTATCCTCAGCATTGCCATCTTTATTGGCGTCCTCCTTGGCACTAGCGTTGGTACTTTCAGTGGTAGTGGCATTAGTGCTGGAGTTGG
TGCTAGCAGTGGTAGTAGCACTAGTGTTGGAGTCGGTACTTTCGGTGGTAGTAGCACTAGTGTTGGAGTCGGTACTTTCGGTGGTAGTAGCACTAGTGTT
GGAGTTGGTACTTTCAGTGGTAGTCGCACTAGTCCTGACGTTGATGCTGGCAGTGGTAGTAGCACTAGTCCTGACGTTGGTGCTGGCAGTGGTAGTAGCA
TTAGTGCTGGAGTTGGTACTTTCAGTGGTAGTCGCACTAGTCCTGACGTTGATGCTGGCAGTGGTAGTAGCACTAGTCCTGACGTTGGTGCTGGCAGTGG
TAGTAGCATTAGTGCTGGAGTTGGTAGTCGCATTGGTACTGGCATTAGCACTACCATGAATGCACGTGTCGCTGTCCTCATCACTGCTGCAATACTTTCT
GCACCTGTCACTGCTATTGCTCTCCTGGAAGCTAGACGGTAACGCAACGATCGACATGGAAGCTGTCGCCTGTTTTTCAGCCAATCTGTCCATTCTTTCT
ATCAGTTCCACTGTGTCAGCAGACAGGTCTGTCCTGGAGCCACAGCATCCAACATGCTGGCCCTTTTTTCCTTTCTTTGATTCAAGTCCATAGAACTCGC
GTACCTGTTCGGTTATACAGCCTTCCTTAATCGGTGGTAATTCACCCTTACGATTCCTTGCCGCCCAACTGTTTTTTCTAGATAATAGATAACAGAGGCC
CCCATCTCTTAGTCTCCCTACGCCTTGAATGAGCTCAATAATATTAAGTCTATTATCAAGCATGATCACCATCATCAATTGCTTAATGTCAATTCCTTCA
GTCACTAATTTCGTTCCGATGAGAACTCGCATGCTACCGTCAGTGACAAACTCCTTTGTGCGAGACACCTTTTCTGCAGCACCCAGCTTCCCGTGTATCC
ATACCACCCTAAAATACTTTCTCCAAGAGCAGGCCAATTCTTCCACTTCGTTGGTTGTGCTTGCAACTACAATGGCCTTCGACTCTGGTTCAATTTCAAA
GAGGGCTAAAAGAAGCTTCAGTGCTTCTTCGGGCTGTGATTCCACTTTCTTCCAAATTTTATGAACATGCCCTAAAGGCACCTCGGATTTCTCCTTGATT
AGATTAAACATCCGTGTTGGATAGCTGGATAGACCTCTGCTGAGATCTTCCGACCGTTTGAGCTCGTTGATGTCCATCGACTTCTTGGCCAGTCCCGTAA
GCCCAATACGCTGCAACGCAGCATCAGCTACAGCCTCAGGTGCTGTGCCGCTCAAAAAGATTGCTTTCTCAAAAGCGTCAAAATCAAGGTTAGTTATGCC
CCCAAATTGCGACTGCCGGTAGACCTCCGTTTCAAAGTTGTGAAACTCATCTACAATGAGGTAACCCAATTTTACGTTGTTGGTCCTAAAGGTGCACTCA
ACAATATTCTCCCACGCAGCTATCCTGTCTGTGAAATTAGTGCTAGCAAGATCATCGTAGATCCCCACGTATAAATCAGTAACGCCATCGCAACCTTCTT
CAATAAAGTTTCTTACAGGGGCCACATTCAAGCAACCGCATCGGCTCAACCTGATCATGCAATTAGCAAGCAACACTGTGTACGGTACAAACAGAAACGA
CACATATTTCACGTCGCCCTTAGACGCCAGTGCTATCAAGGGGAGATGAAATAACTCCGTCTTACCATAGCCCGGTGGGGCCTGTACTGCCACAGAGGGT
GTGTCTGCCATGTATATTTCATGACATAAGCGCAACTGATGCAAGTCCCTGAATTCAAAGGAGCTGCCAAAGAGTTTCCGGCCTGCGACGAGGATATCGT
TTGTACTCTTGGGCTCTCGGGGCCTTTTTCGCGTTACTCTTGAAATTTTTTGATGATGATCTGAACTCGCCGCCTCACCTGCCACTACGTCTTCCGCATT
CCGAGTACTAGAGAATGAACAATGGTAGTCGCTTTCAAGGCCTAACCATTGAATCCAGCGCTCGGAAGCTCGTTCCTGCAATAAAGTGGCGGTCGTCCCA
CTGACACTAGTTAACGAAAAGGAATCCACACCGTAAATATTTCGCCCTGTTTGAACGGAATGATTGGCCATGAGTTCACTCGTCGCCGACTCGTACAAAT
CTGTTTCAAATCTGCTACCTACGCAGTGCCGTCCTAGGGCAATCAACCCCTGACGCATCTCCCGAAAATTCAGCTTCTGAGGTGCATTCTTCGGAAGTTC
CCTCATGTACTGCCGAAAAGTTGCGTATTCAACCAGACAGCCCTTCGCGGTATTCAGAAACATGTAGGAATACAAAACTATCCTCGAAATGTCTCGATTT
GTTACTTGATCTGGATCCTCAAATCCCACCACATCCATCCAAGGATCATGATTAAAAGCGTCATAACTGTTACCAAGCGCACATATTTGCATTTGCCTTA
GCACAGTGACAAAATAAAACACGTAATCTGAAGTGAGTCCGTCAAGCGTCTTTAGTCGAGGCTCCGATGAACCGTTCTTGTTGTATCGTCGACGTATACG
TTGCGCTGAGGACCGGCAAAAGCGAGTAGCTGAAGCTCTGGATAACGGTAAGGGTATCCTACGGCAAAATGGACCATCCACATAAGTGGCACCGTAAGCT
CGTCAATTGCAACAGTGACTTTATTTTTAAGAGCCGCGGTCATTTTGTTAGTATCTCTTCTCAACTTGGGCAGCACAATTTCACGATATTTAACAGGTAT
CATTTGAAGAAAAGAATCGTTCTCCAGATACTCGTCAATTCCTCGCTTTGGCTCTCTGAACAAAACTTCTCGATTACGCAAAATGAGGCTGGCAATATCA
ACCACTGTAGGCATATAAAAGCAGTCGTTCAATTCTTCCCAAAGGTTATCAAACTGAGCCTTGCATGCAAAGTAAAAGCCGCGGACATACTCGCGATTAA
ACAGTTTTCCACATACTGATACACCATCAGAAGAAGGTACCAAAGTTATTCTATAAGAGTCCTTCAGCGCGGTTTCCTGCGCTACTTCGTGGTACAGAAT
TTTGATCCATTTCCACATCGCAACGCCGTTGTTGTCATCAAATATATCTAAATCCCTTGCGGTACAAGCACAAGACGACACCAATAAAGCTTTCACGGCA
TCTAGTGTTTTTCTGAGTCTTCGTGGAGTGTTAGGACTGCGCAACTTACATACTTTCAAGCCATGCTCGTCCACAGAGGGAATAATGGGTTCTTCATTCG
TAATGGATCGATCCTCTTCGTCACCAGCGCCACCACGGGGACCCGCCCCGAAATTGAGCGCACATGCTCGCAAGATAATATGCAAAATATCACCCAATCG
GTCTTTTTTGTTCATCATATCGTTACATATCTGTGAAAAGTACTTTATCTCAATGGGTTTACGTGGGCATAGATCACGCTTCAGCCGCTCTGTGTCGACT
TTCTTTTCGCCAGGTAAACTTGCTTGGTATGCAGAAAAAATCGATAGCTCATCTACGTGTAGTAACAAGAACATGTAGGGTGCCAAATTGTACCCATATT
TCCTTATGGTGCTTTTCTGAAGACTCCTTACAATAGGTGCGCCAGAAACAAAGTCAGTGAAAGTACGCATCGTAGAGCTGTCGTTCGGCCTGGCACTCGC
TATTTCGTGACAACGTTCCAGGACACGGAAACTCAACTCATTATAGTATCCTCTGTTGAGGTAAAAAAGAGAAAGGGTATCGTAATCCTTTCTATTGAAT
TTCAAAGTATGCACTTGAAACAACGTGTAGACCATCAAGTTGATTTTCTTGGGAATAAGATACTTTGAAGGGATTGGTCCGCCCTGGAAATCTGGTTCGT
CTTCAACAAATGTCAGGAACTTTTGTACATTTTTCCCGACCATGACGGAAATGACAATTTTTTCAAAAGACCTTTTCCTATCCATTGCACCAGTTCTGAA
TTTTACCACTTTGATTAGGCCAGACTTTTCGTCTTCGTAGAATGACCGCACTTCCGTGGGGATCGATTCAAATAAAGTTATTGAGGGACAATGTACCAAG
TCGTTTTTGTTATTTAGAGCCGACTCAAACTCGTCAAAGTTTGCTTTTTCAAACTTACGCCTATCGGAAACTTTCATTTTATTTTTGTAAGTTTCGAAAT
TAACAATAGTATGTTGATTGTTATGCTTTTTGACAAGAAATCCATCAATATAAACAAAAGATTGTCCAGTTTCCGTCTTATCATCATCTAAGAATGTAAT
AATTAAGCTACTCTATTGAGAAGAAGCAGAATCTGCGCTATGCAGGTGCAAATCTCCAGCAGCAGCAAAGAAAATTCAGTTAATAAGAAATCTCACTAAG
ATAAGCGACTGTCTGTCCCAACATAGAAAACAGAAGGATGTCTCATTCATCCTTGATTTCCGGCCTGCAAAAATAAAGTAGTCGGTACGTACGTTCGTTT
TCAATTTCCATGGTGCACAGTATCTTAACTATCTGCTTAGTCGAGGAGAACCAGGATTCTGTTCGTTGCTCAGCCGCTTCGTGGATATTCTCTTGGATAC
TTTAAATATGGACCTACGCTTAGCCTGCGCTTAGCCTACAACTTCTTCCGCTCTCGAAAAGACCAATATAATAGAAAGTTATAAATTACATTTCCTTATT
AGGTATACGACCTCGCGCTTCGAAGTAGAGGAGCCCTTTTTGGCGTACCTACATATGGCGCGTCAGACAGACAAACTTCCCCCAAAAATGTATTACCCCG
CCGAATAAGAAAACAGACCCATTCACCCACGACGTATCAAGTTACTTCCTTGGTGCAATGTCCCACTATAAAAAAATTCCTTGACGCTAGATCGTTGGAC
TAAAATCTGCGTCACAATCGCCTAAACAGGAAATATTGCCTATTTTCGTACAAGGTTACTTCCTAGATGCTATATGTCCCTACGGCCTTGTCTAACACCA
TCCAGCATGCAATACAGTGACATATATATACCCACACACCACACCCACACCCACACCCACACCCACACACCACACCCACACCCACACCACACCCACACCC
ACACACACCACACCCACACCACACCCACACACACCACACCCACACACACCCACACACCACACCCACACACACCCGCACACCCACACCCACACCAACCTGT
CTCTTAACTTACCTTCCATTACCCTACCTCTCGACTCGTTACCCTGTCTCATTCAACCACACCCACTCCGAACCACAATCCATTTCTCTACTTACCACTA
CCATCCACCGCCCATCATAACTGTTACCCTCCAATAACCCATATCCAACTCTACTACCATTACCCTACCATCCACATCTGTTACTCACTATACTGCTGTT
CTACCCACCATATTGAAACGTTAACAAATTATCGTAAATAATACATACATACTTATCCTACCACTCTAATCCCACCACCACCACATGTCATACGCACACG
GATGCTACAGTATACCACTCTCAAACTTACCTTACTTTCACATTCCACTCTCACTTCATCAGTACCAAACGCACCCATATCATTATGCACGGCACTTGCC
TCAGCGGTTTATACCCTGTGCCATTTACCCATAATTCCCACGATTATCCACATTTTAATATCTATATCTCATTTGGTGGCCCTAAATATTGTATAAATGC
TCTTAATACATACGTTATACCACTTTTACACCATATACTAACGACTTAATTTATATACACTTATGTTAACATAACCAAAAAATCACCATCAAAATCACCT
AAACATAAAAATATTCCATTCTTCAACAATAAGAATTAAAAAAATTGACTTGGAGTATGAACATGTCGAATGTGATAACCCAAAAGCAAGATATCAGTAA
ATTTTCAGTAATGTTTTGGACAAGGTAAACATATAGCAAACCTCTGATTCAATAGGACTTAAGAAACCATAGTTTCTATGTGCAAAAGAAGTACTTATGT
AATTCTTACATTTGAATAACATATAGAAGGGCCCAATAAACTTACTACATTATGATATATAAGCTAGATCGTAATTCACTACGTCAACGTTTTGTCTGGT
TATGGTGGCTGAAAAAAGTAGTTATTCTACACTTTTAATCTCATCCGCAAAAAAAAAAAGCAAGACGAAAAAAGCAATTAATTGATTCTATTCCATTTTT
TTTTTTGAGTTTTTATAATTTTTTAATGTTTTTGAATTTTTTAGAATTTTCTTATTATAATTTGGACTTCTTTAAATCGACTGAATTTGGCCTGAAACTT
CGCATTTCATCTACAATACCAACTTCTGGAATGTTTCTTACACCTTCTACATTTTCCACCTGAGCATGAGTTACCTCCACAGAAATAGCCACAATTATTA
GCCTTACCTCCTCGTTTGTCAAGAGTACTACCGTTAATAGTCTCGTCCGAAATCAAATCACTTGAGCAGGTCAAGTTTCCTTCGTTGTATTGATCTTGGC
TGATACCCTGGCTGTATAACTGCTGAGCGAAGTCATCAAGCTCTGCGGCAAACTCCTGCAGCCAGGGAAGAATGGGATTATCACCATAAACGGTTATGTC
GTCGATATATGAACCGTTTGTTGCCAATGCAATGGCTGTTAGGCCATTCTCATTACCATCTGTGTACTGAAGATATTGAATGCCATATCCTTCTTGAGAA
GCCTCCCAGTCCATCAAGCTGGTGAAAGCAACGGCACCGAGAACATCTGCAAGCTTCATTCTTTTTAATTCAAGTCTTTTAGTGAATTATTTGCAAGATA
CCAGTCAAGAGAAGAAATAACATTGAAATTATCTTCGAAACCTTTTATAGGGTTGAGAAAAAAATTCTTACATTATATATTTTTATTTTTTTGCAGAGGT
TTGTATTGACTTATAGGGTACTTAGTTATCGGAAATAAAATTGGATACTAATTTGGATAAATATTGTTGGGTCCAAACGGCTAATTGAGAGTGCGTAACC
ATAAAAGTACCCAAACATTATATTCATCCATAGGGCAAATTTTTTCTCGCTCTGCATATCTGTTTGAAATTTTCTCATCCCTTTTTTTTGATTTCTTTTA
ATGGAAATCTGTTGTTTTTCCATCATATGCTGAAAGTTGAAGGGAACTGCTCATTCATTCATTGTTCTCATAAAATTTCTTAGAATTGAAAAAGCCGCGC
ACAATGCCGCGCGAGCATTGTTCCTGCAGCAGTAAATCAGGGAAAAGATGCAGCACTATTTCGACCGCTTTGACATACGAAATTTTGTGATTCTTTGGTT
TAAACTATTTTCAACGGTTGCAAATAGATGTTTTTTAACAATTTTTTGATTTAAAACGACTAGCATTGTCTTTGTTTTTTTTTTTGGTTGCAAGAGTACC
ATTTTTCGCTGTAAATGTTCCTCAAAATGAATAATCATCTTCCTTGCTACAGTAATATTAATGAACGACTTAAAACGCATAATCTCCTAAACGATCGAGC
ATATAAAATTTACAAGGGCCGAATTTTATTGCAAAGCGTATAAATGGTAGCGAGATGGTGTTTCTGTAAAGTTATCTATTAACGAAATAACAGATCATCT
ACTAACAAGATGGTAAACTTAGCTAACGTTTTAACCAACGCGACTGCAGCTACGCTGAGCGCATGGTCTAATACAGTTCCGTTAGAGATATATTTTCATT
TTGATGAGGCATCAGGATTTGGCGACTACTATTTGAATGTATCCGTAATCTGGATGAATGAAACCCTTTATGAAACCAGAATTGTCCCAGCTATTATCAA
TGTCCGCGAATGGCTTGACGATATGGAGGCAAACGATCCTTCACCTAGTGTAACTAACCCATACGAAACTTCAGGTTATTATGCCTTTTCAACAGTAGTA
CCAGTTAGTAAAGTATAAAAAGAAACTGACCCCAATGGCTTATAGAAGCGCATTAACTGTGGCTGGTTCTGCGGGGGTAATATCCATTTTTCTGGGGTAT
TAGCGCCTTGCAAGAGATGCGCTTCTTACCGCACAGGTACTTGGCGAAAGAAGTGTTTACTAATCTGGGGGCCATAAGTCACTAGATAAAGCGTTTTTTT
GAGGTCGCAATATCACGCTTGAAGAGATCTTTTATAATTATTTCTTTTCCAGATCGTAAAATAAATATATTAAGAAATATACATAGAGAATAGCGCAATA
CTATGAGATGTTTTGTCTCAAGGTTGGGATATCGATTTAACTGTCAAAACTTTGGCTTTGTTTGTCAAGGACATGTACCAATGAAGTAAATACTTTCTTA
GGTTTATTGAATATATCTTCCGGGTTGTTTTGTACACTTCAAATGGAATGATTAAGAGTGAAGGATATCAATTTGCATATCACATGTGAATATAAGTTTT
TCTAGACGGAAATCATAGTCGCAGTTGGGCCAGAAAAAAAGTTTCTACGAAAGAATAAAAAAAATAAAAGGAAATCTAATTCAAATAAAAACGTTTAGTT
TTTTGAACCGATGAAAACTATCTAGGCAATATTTCTCTGTTTTGACTACAATCAAAGCTTCAAATCATAAAAAAATTTCTCTTTAGGAGCTCACATACTG
ATGAGAATTTTTTTAAATATACACAGAATATGATAAAATAGCAGCAGCATCTTTATTTGTTTGGTGAACCGTACTAATCCATTGAACGAAAGCTGAAGTT
CCAAAATGAAAATTAGACAAACTTTGAAATAATTGTTGGGATTCCAAAAAAATAATAAAATAACAATATTATGTGTATAAAGTATACTAGAAATTCTTCT
CGCGAATTCAGGGATCCAGAAAAGACGACCGACAATTTTATATAACTTTTGCATTCGTTTTTTCTTTTGTTTCATTCGTCGTCATTCATCGATTCTATCG
CACTAGTAATCCTTGCGTTATGATTTTCCCTAAATTCGATGACTAGTCTGGATCGTATTTAAGTAGTCTTATGCCTTATGTTCTCTTCTTAGTATTGTAT

567,699bp truncated ...