Sign In

GLBRC Y22-3 ( GCA_001634645.1 ) - CM004301.1
Saccharomyces cerevisiae strain GLBRCY22-3 chromosome VIII, whole genome shotgun sequence

>CM004301.1 Saccharomyces cerevisiae strain GLBRCY22-3 chromosome VIII, whole genome shotgun sequence
CACACCACACCCACACACACCACACCACACCACACCCACACCACACCACACCCACACACCACACCCACACACCACACCCACACACCACACCCACACCCAC
ACACCCACACCACACCCACACACCACACCACACCACACCCACACACCACACCCACACCCACACCCACACCACACCCACACCCACACACCACACCCACACC
ACACCCACACACCCACACACCACACCCACACACACACCCACACCCACACCACACCCACACACCCACACACCACACCCACACACCCACACACCCACACACC
CACACACCACACCCACACACCACACCCACACACACACCACACCACACCCACACCACACCCACACCACACCCACACCACACCCACACCACACCACACCCAC
ACACCACACCCACACCCACACCCACACCACACCCACACACCACACCCACACCACACCCACACACACACACCACACCCACACACTAACACTAACACTAACA
CTAACACTAACACTAACACTAACACAACCCTACCCTTTTCTAACCCTGACCAACCTGTCTCCAAAGTTACCCTCCATTACCCTACCTCTCGACTCGTTAC
CCTGTCTCATTCAACCATACCACTCCCAACCACCATCCATCTCTCTACTTACTACTACCATCCACCGTCCACCATAACCGTTACCCTCCAATTACTCATA
TCCTGCTCCACTACCGCTTACTCTACCATTACCCTACCATCCACATCTGCTATTCACTATACTACTGTTCTACCCACCATATTGAAACGTTAACAAATGA
TCGTAAATAATACATACATACTTACCCTACCACTCTAATCCCACCACCACCACATGTCGTACGCACACGGATGCTACAAGTATATACTATCTCAACTTAC
CCTACTCTCATATTCCACTCCACTCCATGGCCCATTTCTCACTTCATCAGTACCAAACGCACCCACATCATTATGCACGGCACTTGCCTCAGCGGTTTAT
ACCCTGTGCCATTTACCCATTATTCCCACGATTATCCACATTTTAATATCTATATCTCATTCGGCGGGCCCAAATATCGTATAAATGCTCTTAATACATA
CGTTATACCACTTTTGCACCATATACTAACCACTTAATTTATATACACTTATGCCAATATTACAAAAAAATCACCACTAGAAACACCTAAACATAAAAAT
ATTCTATCTTTCGACAATAATACATAAACACACTCAATTGCGTATCAATACCACCATGACGTCATTAACTTAAATGTTCCTTAATATCGTCATACCACTA
TGCTCTATAGTCATGCAGATGCTTTCACTTCGCCCTATCTTCCCACACTATTGTCATAGAATCTCACACTAACGCATGATTAAAACGAATAATTTTTACT
GTAAGGGCTGCCATCCGTGCTCTATCCTTTTGTTTGTAATATTTATATACAGAATCTCAAAGCAAGCGGGAGAAGTAGTAATTACCCAGAGGTCATGCGT
GATCTGAGCATCACCGTACTCTAAGTTTTGCTTTGATCCGTTTTACAGTGACACCGAACATAAGGGGAAGCTATTGACATGGTATCGAAAGGTTGTCCAC
ATTGGGAAGTAACTTGGTTCTATGAATCTTCATGTAAGATATTCGTAAGACAGACTCTTTCCCGTGTAAATATTTGTGACAGCTACGTCTATTTTCTACT
AGATGTTTACACAGTTTTGTCACAGGAAATCTACGCTTAAAATATGTGTTTCATTCAAGCGGTAACCGCTGTACGAGCAGTGACATTACCGGTCGCACCT
TAAATGTGAACCAACGTTACGGCACACCGTGATGCACCCGCATTAAAGTTTTGTAAATGCGTTATTATAACTATCGAGTGAGTTAGATAGAAAATCGGAA
ATGAAATGGATACCCTTTTCGAATAGCACAGTTTATCTGCCTAAAATAGCCCAACATTGTTGCCCTTTTTCTGTCCCGAGGTTACTGAGCCATTGCATGA
ATGCGCGCGCCTCGGCGGCTTTTTTTTTCTGCTATATAAAAGCGAAAAGCCAGAAGTTACTATCTCGAATAAAAAAACCCTCGAACTGCTATCTCACTAC
CGAAAATGAAAGGAAATGAACTTAAAAATGAGAAAAGTGTAGATGTATTATCCTTCAAACAGCTCGAATCCCAAAAGATTGTTCTACCTCAAGATCTTTT
CAGAAGCAGCTTTACCTGGTTTTGTTATGAAATTTACAAGTCTTTAGCGTTTCGCATCTGGATGCTATTATGGCTACCACTTAGCGTCTGGTGGAAACTT
TCCAACAATTGGGTTTACCCACTTATAGTTTCACTTCTTGTCCTGTTTTGGGGACCAATATTTCTTCTTTTTATTCGTGAACTTTCTCGTAAGCGTTCCT
TATCGAAAGGACTCATTCAGTTTTGCAAAGAGATTACTGAAAACACACCAAGTTCTGATCCTCATGATTGGGAAGTTGTTGCAGCAAATCTAAATTCGTA
CTTATATGAAAATAAGGCTTGGAATACTAGGTACTTTTTCTTCAATGCCATGGGCTGCCAAGAAGCGTTCAGAACAACCCTTCTCGAACCCTTCTCTTTG
AAAAAAGACGAAGCTGCCAAGGTTAAGTCGTTTAAGAATTCCGTCCCTTACATTGAAGAAGCATTGGGAGTTTATTTTACTGAAGTTGAAAAACAATGGA
AGTTGTTTAATACTGAAAAATCATGGAGCCCTGTTGGCCTAGAAGATGCTAAACTTCCCAAAGAAGCTTACCGATTTAAGCTTACCTGGATTCTTAAAAG
GATTTTCAACCTGCGGTGTTTACCACTCTTCCTTTATTATTTTTTAATTGTCTACACGTCTGGAAATGCTGACCTTATATCACGTTTCTTGTTTCCGGTA
GTAATGTTTTTTATCATGACGAGAGATTTCCAAAATATGAGGATGATTGTTTTATCCGTGAAAATGGAACACAAGATGCAGTTCTTGTCAACTATTATAA
ATGAGCAAGAAAGTGGCGCGAATAGATGGGACGAAATTGCAAAGAAAATCAATAGGTTTTTGTTTAAGAAGAAAGTCTGGAATAATGAAGAGTTTTTCTA
CGATGGACTTGACTGTGAATTGTTTTTCAGCTGCTTTTTCTATCACCTTTTATCTTTAAAAAAACCTATGTGGTTTGCCTCGTTGAACGTTGAGCTATGG
CCATACATTAAAGAAGCGCAATCGGCCCGCAATGAGAAGCCCCTAAAGTAGGAACAAATGTTCTTTTTCCAAAATATACTTTGTGTAGTTGATCGAATAT
GAGTAAGTCAAAACGTATTTTACTTGTTTATTATTATTAAAACTCTTTTTCGCATATGTCATATCACTTTACACCATACAATAACCACTAAATTCAAAGA
TACTTATTTTCAATATTTTTTATAAAAAAAATCACCACTAAAATCACATAAACATAAAAATATTCTACCCTTCAGCAATAAGACTGAAACACTTTACTTG
GGGTAAGAATACTGCCATGGTGTCATTAGCGTGAAAGTTCCATAATGTTTTCATACTAATCAATATGTACACAGGCTTCACATTAGAACATCATATATTA
AAGCGGTAACTTAAAATCCAGATAATACATTTTTGGTCATATACGTGCTTTTTTTTTGTAGGATATAATCGCAAATGATATCACTACACTATGACATATT
GTTGACGTAGTAAATTACGATTTAGCTTATATGTCATAATGTAGTAAGTTTATATATGTTATGTAAATGTAAGAATTACATAGGTACTGTTTTTGTACAC
AGAAGCTATAATTTCTCCAGTACTACCGGATTAGAGGTTTGCTACAATACGTTTTCCACTATATGTTTTCTATGTGTGAAACATTACTGAAACATTACTC
ATATTACGCTTTTGTGTTATCACATTAAACATATACATGGTAACAAATATTACTATCACTTATCTTGCTTCATCTTATGTACCATACAAAAATTACTGCG
CATATCAGAGATCATTTTTTCTAACACATATCCTGTTGGGGTTTTGTAAATCGTTCTTATGACTTGCCTAAGGCCTTTGCAAAACGTTTCGCGATCCAGT
CATTGATAGGATCATCTTCCTTGGTTTGGACATATTCTCCGTCAGGTAACTTTTGGGCAAAATCTTCAGTCAACCGAGGATCTCTTACGCAGAATGTTAG
AAGGAACATAGGCGCTGAAAATACAAGCGCAACAATAACTTCGTATTTTTGAACGTGTCTGTAAGCTTCAACCATCGCAGACCTAACTAGAGTACCCCAG
GGATTGGAAAGAATAAAAGTTAGTGGTGAGCCATATGCTGCTGTAGCCAGGTCAGCGTCTCCCATGTAGTGCAATAATTTAGGGTACAATGATTGCGTCC
ATATGGCACCGGAAATGGCAGCTGCAACTGCTCCACCTATTCTGAAAACTGTATAGTTTAATGCTGTGACAGTAGCCATATTCTCATGGGATGTTACCGA
CTGAATAGAAACAATTGTGGGATAATCGAATAAACAACTACTGAGACCCCAAATAACCATACCAGCAATTATACCTCCATCAGCGTCTTGACCTGACCTG
TAGCGGTAAAATAGTCCCATAGTAATGAAATAAAGTGAGCTACCAAAAATAATATACGACTTCAATCTAGATGATCTCGTAACGATGAGCCCAAGAAATG
GAGCAACAACAGCAGCCACAAAAGAGTATAAGTTTATTATCCTTGTAGCTGAAGAAGCGCTCTCATCTACCGCAACTACTAGGATAGTGTAGAGATACCC
AGCAGCCATTTGATATACAAAGCAGATAAAAAACATAATTCCCAATGGAGCCCACACGCCACGATCTTTTAGCAGCTTGAATGGAGCGAAAGGAACCAAA
GCAAGTCGACTTTCCCAATATATGAAGCCTGGAACCAGGACAAAGCCAAGCACAAAGGGCCCGATAATCTTTGAATTTCTCCAATTTGTAGAGACGCCAC
CAGCAAGAGTGAGTGGTACAAGAATACAACCAACACCAGCAGTAAACAACAACACACCGACAACATCTAGCTTCCAGAACAACTGTACCAGCATTTGTAC
TAATCCGTGCGTTTGATAGTACGATTTTTCATCCTGTAATTCTTTCCATTCCACGTCATTTCTTACTTTCCATCTCATATGGAGCATACACAAAATCAAT
GGGATACAGCATAGAGGGAAAATGAACGCCCACATAGCAATATTCCACGACCAGTTCTCTAACGGGTTCGCTGCCTCCACTACACTACCTGAGACCCACG
TAGTGATAATCGAGGGCCATGAAGGTATCAATGTGTAAAATAGCCTCCATTTTAATGAAGAATTATCAGACAACATCAGAACAACCTGTAGCATAACACC
GACAAGTCCCACATAATAAAAGACAGCTCCAGCAGCATACCTCTGGACATCATATGCTTGAGATTGAATTATTGTACCCACAATGTAAAGTACAATGGAT
ACAAGAAACAACGTTAGCCTTCCAAAGATATCTGATAACCCTCCAAAGATCACCTGTGAAACAGCAGATATCATTAGAACTATGACGCTTACTGTAGAAA
TGAGAGAATGTGCGGAGTACGAGTTCATTGCGTAGGTCATATATGTACCCCTTATGCTGCTATCTAATCCATAAGCGAAAGTGCAAATGAATGCAGAAAA
CAGGAATATAGCTTTTAATTGCCAAGTATCATACTTTTTAGCCATTAGCTCTGACTTACGAATAATCAATGATTTTGTTCCCTTTAATTTATCTTTCATT
TCATCTCTGGGCGACGAATCGTCATCCATCTTTTCATCAACCATCAGTTCATTACAAATTTTTTCAGTATTCTTACGCTTTGTTTGGCTAGAACGATTGT
CTTCTGGGACTTCGATCATATTTCCTTTGGCCCAAAGAGTTACAACTTTTTTTGGAGCTCAAGTGGAAAGGACACAAGCAAAGTTCTTCTACCAGGATCT
CATGTCTTTATAGAAAAAAGTAAGGTGTAAAAAGGCTACTGGGTAAAATTCACCACGTTATCTTCTTAACTTGCCCTTAGTGAAAAGCTGTATTATTTCA
GCTTCTGTGCAGATTAGTGGGTAACTGTCTTAGATTTGTGGAATCGGAGCACAGAAACTCCAGTAGGGTTGTTACGGACTACGTTCTGAAAGTATATTCC
GTTTTTTTAAAGCAGGTGCAAGTTACTGGCATAACAGGACCCATCACTTCAGCCACAGCTTTGCTTCTAAAGATATATACGACATACTGGTAAAGCACGG
AGCCCTACGGACGCTCAAAGTTATTCTTTTTTTTTTGTTCCTTACTGTGAACTAAAAACTGCACCCATTTTCTGACTGCTTGCTTGAGATAGGTACTTAT
ATACCGAGTGTTTGTATATAGCAAAGGTAGAGGGAGAACGGATTGCACACAACCCGGCCTGACAGGGAAATTTAATATCTGCAGGAAAGTTTCGTATGAT
CCCGGACGGGAGGGAAACCTTTAGAATTTAATAAAAGACGATCATTGGACTCACATAATTTAAATTAACAAGGAAAAATATTGCTAGGTAGGTTGTCGAC
AACTCAATATATATGAAAAAAAAAGAAAGATGCTAAAACGAGGCTTTTTTCTTTTGGACAAGGGGAGTCCAACCGCCCTGCATAAGTTTATTCAGCCTGT
GAATGACTATAAACCATATATCATACTTCTTGCTTCTTGCTTCTTTATACATTTTTTTCAATGGAAATATTTATATAGAAAGGGCGCTGCGCTTTTTGAG
GTGAATGTTTTCATTTTTCAAGTTATTCAGTAGCGTTACCCAGTTGAGTGGATAGAGAATTCAAGTTTAAAGCTCATCTCAAACAAACAGTAAAGGATTC
TACGCGGTACAGACTTATTTCCTAGTCGAGCATGATTCGATCATTGACATATATCCCATCTCTTGATCTAAGACTTGATCATTTTCTTAAAATTAAGAGT
TTTGGGCAAGTGTAAAGGCAAAGGTTAAATGATTATGTAGTTATGGAAGTACCAAATTCAAGTTCGTAAGAGGCTTGCTTTCTACTGATATATAAAACGC
TCGACCGATTGGTTCTTCAATTGGTATAGCTAATAACTATAGCTGGACTAATTAAGACTTCAAGGACGTCTTACGCAAGCGTGGGTGATTTTATTATTAA
ACAATTTTTCTGTCTCTATACGCATATACGTTCAATAACATAAATATGTAATGGATACTAACCTTTTTCTGTGATTAACTTACTCTTTGCGTTACACCTC
CATCTGACTCATGAAACAGGAAGACTCAGATTTATTAAGTTTAGCATTTACGCCGCAAATGGTAAATGCTCCGGCCCGATACCCTGAAATAGCAACATGT
ACAAAAGAAGGTATTCAACTGAAGCCTTTTAGACAGACAAGACTATTGGATTATCAAGGCACTATATTTTACCACTACAGTAAATACTTCTGATAAGAAC
GGCATGAATAATCAAGTAGGTCTTATAATACTGGTATACATTAATATAATCAACTATTTATACTATCAAAAAAAAAAAGCTTTTTTTTCGTTTTTTTAAG
TTTTATGGAATTTCATTGTTAAAGGCGTTTGTCTCTAGTTTGTGATAGTGTAGATACCGTCCTTGGATAGAGCACTAGAAATGGCTGGCTTTAATCTGCT
GGAGTACCATGGAACACCGGTGATCATTCTGGTCACTTGGTCTGGGGCAATACCAGTCAACATGGTGGTGAAGTCACCGTAGTTGAAAACGGCTTCAGCA
ACTTCGACTGGGTAGGTTTCAGTTGGGTGGGCGGCTTGGAACATGTAGTATTGGGCCAAGTGAGCTCTGATATCAGAGACGTAGACACCCAATTCGACCA
AGTTGACTCTTTCGTCGGATTGAGCTAGAGTGGTGGTTGCGGAAGCAGTAGCAGCGATGGCGGCAACACCAGCAGCGATTGAAGTTAATTTGACCATTGT
ATTTGTTTTTTTTGTTAGTGCTGATATAAGCTTACTAGGAAAGAAATTAAAAAAGGCATATCTTTAAGACATGGGACAGAAGCAGCTCTATTTGTACCCG
TTCCTCCATCAGTCATCACTACTTAAACGATTCGTTAACAGATGCTCATTTAGCACCTCACATATCCTCCATATCTCATCTTTCACACAATCTCATTATC
ACTATGGAGATGCTCTTGTTTCTGAACGAATCATACATCTTTCATAGACTTCGTATGTGGAGTATTGTTTTATGGCACTCATGTGTATTCGTATGCGCAG
AATGTGGGAATGCCAATTATAGGGGTGCCGAGGTGCCTTATAAAACCCTTTTCCGTGCCTTTGAAGTTTCCGTTTTCGGTCAAAAAGAATATCCGAATTT
AGATTTGGACCCTCGTACAGAAGCTTATGTTTAAGCCCATATTCAATTTGCTGTAAACGGCCTCCAATGGAAGAGGTAATGCTATATTATCCCTCTCCTG
ATAGTTTAATTAAAAATAGAAAACGTGTATTGGGAGTCGCTTATTTGTAGAGTTTGTAGTTTTTAAGCGTTCTCAGGAAATTCATTGACGCAATTACGTA
ATTTTAGGCCGCTGAGAAGCAGCTAGTATTGAAAGAGCCGCTTATGGTAAAAAAAAAATGTTGAGTTCAGTTCGTAGCAGTACTACAACTCTGTGCGGTG
GAAAAAATTAATTCATCGAGGCACAGTATTTTTCTTCTAGCTAGATATAAAGAAAAGTGAAAAAGGCAATATATGGCGCTAATGTATTTTATTCAATTAA
AAACTTTCTGTAGGAAATGGTATTAATAGTTGGTATTCCTTGTAGACAAAACCATCGCTATATTCATGGTGACGGCTCATCTCTAGAGCTCCTTAAATGT
ACAGTCAGCTAAGTGTTCTCATAAGAAAGGGTTTGAAGAAGTCTTCGATAGCGTGCTTTAGTATGTTGACGAAAGAAATCAAGATCTAGCTTATATGTCA
TAATGAAGTAAGTTATATTGGAGTTTTTCTGGTAAATTCTACAAAAGTTATGCAACATACTTATTTCTATCCTCTTCTTACTCGTCTTGCGGCCAAAACT
CGAAGAAAAATATACGGGCCAAGAAAAATAATGCAATCCTCCCAGTTCTAGATATTCCCGCTTTTAAGTCCCGAATTATAACAATATAAAAAGGATATAG
AAAATGTAATTGTTAACTTGTGGTATGAAGACAAATTCAAAAGCAAGTGAGGGCCCGCTAAGGCTATGAGTTCAGAATTATTAATATCTGATTCTAAACC
AAGACCAGAAGGATTAAGAAAATTATGCGAAGGTGAGACAGTGATCCTTCCAAGGGACATAACCCCCCAGCAAATGCGCTTATTTCTTAAAACAGAATAT
CGTACTCATTTCATATATTTTCATCCATATTATTATTACCATAATCTTAAACCGCCTGGCATTATCTGCACACGGTAATACTTTGATTATTATCTTAGCG
GCTTTACTAATTACAATTTCACTATTCCTTTTACTCCTCTTACCTTACTTAAACTGCTCAAGATATAAGTTAAGATGTTTAGATGATGATTGTAAGTTCA
AACTATTAGCGGAAGTCATTACACATAAACCTAACGTGGACTTGAGCACATGGGACCGGATCGCATATGACATGAACCAATTTGTATATGACCGTCGTAT
ATGTGCAGATAGATCTTTTTTCTACGATGGCAGTTCTTGCTATCAGGTTTTTAGAAAGTTGGTGGCTACCCCGTACCTTGTGAATTCCAATATGAATAGT
ATATATGCTGATCTGGAGATGAGAAGTAATGCAGCAACCAACATTAATGATTCTGGTAATAGTTCATTACATATCGAATTGGGCACTTATATTTTTAAAG
CATTGGCCGTTTTCAGGAACTCTGTTGACAAGTACTGGGAGGATAAGTATCCAGAGATGGGGGACACAGTTTGATTGGAAGGTATTTCTAGGTTCTACTT

539,823bp truncated ...