Sign In

GLBRC Y22-3 ( GCA_001634645.1 ) - CM004303.1
Saccharomyces cerevisiae strain GLBRCY22-3 chromosome X, whole genome shotgun sequence

>CM004303.1 Saccharomyces cerevisiae strain GLBRCY22-3 chromosome X, whole genome shotgun sequence
AAAAAAAATTTCTTACAATATACTATACTACACAATACATAATCACTGACTTTCGTAACAACAATTTCCTTCACTCTCCAACTTCTCTGCTCGAATCTCT
ACATAGTAATATTATATCAAATCTACCGTCTGGAACATCATCGCTATCCAGCTCTTTGTGAACCGCTACCATCAGCATGTACAGCGGTACCCTCGTGTTA
TCTGCAGCGAGAACTTCAACGTTTGCCAAAATCAAGCCAATGTGGTAACCAACCACACCTCCGAAATCTGCTCCAAAAGATATTCCAGTTTCTGCCGAAA
TGTTTTTATTGTAGAACAGCCCTATCAGCATCGACAGGAATGCCGTCCAATGCGGCACTTTAGATGGGGTAACTCCCAGCGCAAGCTGATCTCGCAAGTG
CATTCCTAGACTTAATTCATATCTGCTCCTCAACTGTCGATGATGCCTGCTAAACTGCAGCTTGACGTACTGCGGACCCTGCAGTCCAGCGCTCGTCATG
GAACGCAAACGCTGAAAACTCCAACTTTCTCGAGCGCTTCCACAAAGACCGTATCGTCTTTTGCCTCCCATTCTTCCCGGCACTTTTTCTCGTCCCAGTT
CAAAAAGTACTGCAGCACTCTGTCTTCGATTCACGCAAGTTGCTCCATACTTTATAATACAACTCTTTGATCTGCCTTCCAGACATGCGGAAACTTGGCT
CCCTTGCTTGCCTCTTGTCGAATCCAATACACTAATTGTTTCTCTTCTTCTAGTAATGGCCAGGTACCAAGCATAATTTCTCTGTATCTGAGAGTAGATC
TCTCTCCTTTTTACGCTAAAATATTTTCAAATATCCTACAGGGTCCCCATGATATGGCTCGATGTCTTCCAAGTATTCTTTGTATTCCTCATCATTTCGC
AGCATTCTCTCCACAGCTAGTGCTTCCCAAGCTATCCTCCGATACGATACTTTCTGGCCAGCCCAACAGACACAGAGCTCGAACATCTTTTGACAGCCCT
TGCATAATCCGTATTGTGTGAATACTCCCTCTGGGCAGAAGTATACGTCAATACCATAGAGGAAAAGATGTTTAATTTCGTCAGACCGAAATCCAAGAAA
CTGTAAGACATTCATATTCTCGGAAGTATTGGGAAATTGTGCTTTCAGTTTCTTTCTCTCTAGCAAAACCATTTGACTCCCTTTCCGCTTATACGACTCT
TTGTTAATGTCGGTGACTGGATGGAATCTATTATCCTCAGCATTGCCATCTTTATTGGCGTCCTCCTTGGCACTAGCGTTGGTACTTTCAGTGGTAGTGG
CATTAGTGCTGGAGTTGGTGCTAGCAGTGGTAGTAGCACTAGTGTTGGAGTCGGTACTTTCGGTGGTAGTAGCACTAGTGTTGGAGTTGGTACTTTCAGT
GGTAGTCGCACTAGTCCTGACGTTGATGCTGGCAGTGGTAGTAGCACTAGTCCTGACGTTGGTGCTGGCAGTGGTAGTAGCATTAGTGCTGGAGTTGGTA
CTTTCAGTGGTAGTCGCACTAGTCCTGACGTTGATGCTGGCAGTGGTAGTAGCACTAGTCCTGACGTTGGTGCTGGCAGTGGTAGTAGCATTAGTGCTGG
AGTTGGTAGTCGCATTGGTACTGGCATTAGCACTACCATGAATGCACGTGTCGCTGTCCTCATCACTGCTGCAATACTTTCTGCACCTGTCACTGCTATT
GCTCTCCTGGAAGCTAGACGGTAACGCAACGATCGACATGGAAGCTGTCGCCTGTTTTTTCAGCCAATCTGTCCATTCTTTCTATCAGTTCCACTGTGTC
AGCAGACAGGTCTGTCCTGGAGCCACAGCATCCAACATGCTGGCCCTTTTTTCCTTTCTTTGATTCAAGTCCATAGAACTCGCGTACCTGTTCGGTTATA
CAGCCTTCCTTAATTGGTGGTAATTCACCCTTACGATTCCTTGCCGCCCAACTGTTTTTTCTAGATAATAGATAACAGAGGCCCCCATCTCTTAGTCTCC
CTACGCCTTGAATGAGCTCAATAATATTAAGTCTATTATCAAGCATGATCACCATCATCAATTGCTTAATGTCAATTCCTTCAGTCACTAATTTCGTTCC
GATGAGAACTCGCATGCTACCGTCAGTGACAAACTCCTTTGTGCGAGACACCTTTTCTGCAGCACCCAGCTTCCCGTGTATCCATACCACCCTAAAATAC
TTTCTCCAAGAGCAGGCCAATTCTTCCACTTCGTTGGTTGTGCTTGCAACTACAATGGCCTTCGACTCTGGTTCAATTTCAAAGAGGGCTAAAAGAAGCT
TCAGTGCTTCTTCGGGCTGTGATTCCACTTTCTTCCAAATTTTATGAACATGCCCTAAAGGCACCTCGGATTTCTCCTTGATTAGATTAAACATCCGTGT
TGGATAGCTGGATAGACCTCTGCTGAGATCTTCCGACCGTTTGAGCTCGTTGATGTCCATCGACTTCTTGGCCAGTCCCGTAAGCCCAATACGCTGCAAC
GCAGCATCAGCTACAGCCTCAGGTGCTGTGCCGCTCAAAAAGATTGCTTTCTCAAAAGCGTCAAAATCAAGGTTAGTTATGCCCCCAAATTGCGACTGCC
GGTAGACCTCCGTTTCAAAGTTGTGAAACTCATCTACAATGAGGTAACCCAATTTTACGTTGTTGGTCCTAAAGGTGCACTCAACAATATTCTCCCACGC
AGCTATCCTGTCTGTGAAATTAGTGCTAGCAAGATCATCGTAGATCCCCACGTATAAATCAGTAACGCCATCGCAACCTTCTTCAATAAAGTTTCTTACA
GGGGCCACATTCAAGCAACCGCATCGGCTCAACCTGATCATGCAATTAGCAAGCAACACTGTGTACGGTACAAACAGAAACGACACATATTTCACGTCGC
CCTTAGACGCCAGTGCTATCAAGGGGAGATGAAATAACTCCGTCTTACCATAGCCCGGTGGGGCCTGTACTGCCACAGAGGGTGTGTCTGCCATGTATAT
TTCATGACATAAGCGCAACTGATACAAGTCCCTGAATTCAAAGGAGCTGCCAAAGAGTTTCCGGCCTGCGACGAGGATATTGTTTGTACTCTTGGGCTCT
CGGGCCTTTTTCGCGTTACTCTTGAAATTTTTTGATGATGATCTGAACTCGCCGCCTCACCTGCCACTACGTCTTCCGCATTCCGAGTACTAGAGAATGA
ACAATGGTAGTCGCTTTCAAGGCCTAACCATTGAATCCAGCGCTCGGAAGCTCGTTCCTGCAATAAAGTGGCGGTCGTCCCACTGACACTAGTTAACGAA
AAGGAATCCACACCGTAAATATTTCGCCCTGTTTGAACGGAATGATTGGCCATGAGTTCACTCGTCGCCGACTCGTACAAATCTGTTTCAAATCTGCTAC
CTACGCAGTGCCGTCCTAGGGCAATCAACCCCTGACGCATCTCCCGAAAATTCAGCTTCTGAGGTGCATTCTTCGGAAGTTCCCTCATGTACTGCCGAAA
AGTTGCGTATTCAACCAGACAGCCCTTCGCGGTATTCAGAAACATGTAGGAATACAAAACTATCCTCGAAATGTCTCGATTTGTTACTTGATCTGGATCC
TCAAATCCCACCACATCCATCCAAGGATCATGATTAAAAGCGTCATAACTGTTACCAAGCGCACATATTTGCATTTGCCTTAGCACAGTGACAAAATAAA
ACACGTAATCTGAAGTGAGTCCGTCAAGCGTCTTAAGTCGAGGCTCCGATGAACCGTTCTTGTTGTAATCAGTGTACAGTTGGATGCGTCTTGTTGTATC
ATCGACGTATACGTTGCGCTGAGGACCGGCAAAAGCGAGTAGCTGAAGCTCTGGATAACGGTAAGGGTATCCTACGGCAAAATGGACCATCCACATAAGT
GGCACCGTAAGCTCGTCAATTGCAACAGTGACTTTATTTTTAAGAGCCGCGGTCATTTTGTTAGTATCTCTTCTCAACTTGGGCAGCACAATTTCACGAT
ATTTAACAGGTATCATTTGAAGAAAAGAATCGTTTTCCAGATACTCGTCAATTCCTCGCTTTGGCTCTCTGAACAAAACTTCTCGATTACGCAAAATGAG
GCTGGCAATATCAACTATTGTAGGCATATAAAAGCAGTTGTTCAACTCTCCCCAAAGGTTATCGAACTGAGCCTTGCATGCAAAGTAAAAGCCGCGGACA
TACTCGCGATTAAAAAGTTTTCCACATACTGATATACCATCAGAAGAAGGTACCAAAGTTATTCTATAAGAGTCCTTCAGCGTGGTTTCCTGCGCTACTT
CGTGGTACAGAATTTTGATCCATTTCCACATTGCAACGCCGTTGTTGTCATCAAATATATCTAAATCCCTTGCAGTACAAGCACAAGACGACACCAATAA
AGCTTTCACGGCATCTAGTGTTTTTCTGAGTCTTCGTGGAGTGTTAGGACTACGCAACTTACATACTTTCAAGCCATGCTCGTCCACAGAGGGAATAATG
GGTTCTTCATTCGTAATAGATCGATCCTCTTCGTCACCAGCGCCACCACGGGGACCCGCCCCGAAATTGAGCGCACATGCTCGCAAGATAATATGCAAAA
TATCACCCAATCGGTCTTTTTTGTTCATCATATCGTTACATATCTGTGAAAAGTACTTTATCTCAATGGGTTTACGTGGGCATAGATCACGCTTCAGCCG
CTCTGTGTCGACTTTCTTTTCGCCAGGTAAACTTGCTTGGTATGCAGAAAAAATCGATAGCTCATCTACGTGTAGTAACAAGAACATGTAGGGTGCCAAA
TTGTACCCATATTTCCTTATGGTGCTTTTCTGAAGACTCCTTACAATAGGTGCGCCAGAAACAAAGTCAGTGAAAGTACGCATCGTAGAGCTGTCGTTCG
GCCTGGCACTCGCTATTTCGTGACAACGTTCCAGGACACGGAAACTCAACTCATTATAGTATCCTCTGTTGAGGTAAAAAAGAGAAAGGGTATCGTAATC
CTTTCTATTGAATTTCAAAGTATGCACTTGAAACAACGTGTAGACCATCAAGTTGATTTTCTTGGGAATAAGATACTTTGAAGGGATTGGTCCGCCCTGG
AAATCTGGTTCGTCTTCAACAAATGTCAGGAACTTTTGTACATTTTTCCCGACCATGACGGAAATGACAATTTTTTCAAAAGACCTTTTCCTATCCATTG
CACCAGTTCTGAATTTTACCACTTTGATTAGGCCAGACTTTTCGTCTTCGTAGAATGACCGCACTTCCGTGGGGATCGATTCAAATAAAGTTATTGAGGG
ACAATGTACCAAGTCGTTTTTGTTATTTAGAGCCGACTCAAACTCGTCAAAGTTTGCTTTTTCAAACTTACGCCTATCGGAAACTTTCATTTTATTTTTG
TAAGTTTCGAAATTAACAATAGTATGTTGATTGTTATGCTTTTTGACAAGAAATCCATCAATATAAACAAAAGATTGTCCAGTTTCCGTCTTATCATCAT
CTAAGAATGTAATAATTAAGCTACTCTATTGAGAAGAAGCAGAATCTGCGCTATGCAGGTGCAAATCTCCAGCAGCAGCAAAGAAAATTCAGTTAATAAG
AAATCTCACTAAGATAAGCGACTGTCTGTCCCAACATAGAAAACAGAAGGATGTCTCATTCATCGCTTGATTTCCGGCCTGCAAAAATAAAGTAGTCGGT
ACGTACTTTCGTTTTCAATTTCCATGGTGCACAGTATCTTAACTATCTGCTTAGTCGAGGAGAACCAGGATTCTGTTCGTTGCTCAGCCGCTTCGTGGAT
ATTCTCTTGGATACTTTAAATATGGACCTACGCTTAGCCTGCGCTTAGCCTACAACTTCTTCCGCTCTCGAAAAGACCAATATAATAGAAAGTTATAAAT
TACATTTCCTTATTAGGTATACGACCTCGCGCTTCGAAGTAGAGGAGCCCTTTTTGGCGTACCTACATATGGCGCGTCAGACAGACAAACTTCCCCCAAA
AATGTATTACCCCGCCGAATAAGAAAACAGACCCATTCACCCACGACGTATCAAGTTACTTCCTTGGTGCAATGTCCCACTATAAAAAAATTCCTTGACG
CTAGATCGTTGGACTAAAATCTGCGTCACAATCGCCTAAACAGGAAATATTGCCTATTTTCGTACAAGGTTACTTCCTAGATGCTATATGTCCCTACGGC
CTTGTCTAACACCATCCAGCATGCAATACAGTGACATATATATACCACACCCACACCACACCCACACACACCCACACCACACCCACACACCACACCCACA
CACACCACACCCACACCACACCCACACCCACACACACCACACCCACACACACAACCACACCCACACACCACACCCACACACACCACACCCACACCCACAC
ACACACCACACCCACACCACACCCACACCCACACACACCACACCCACACCCACACCACACCCACACACACCCACACCCACACCCACACACTAACACTACC
CTAACACAACCCCTAACCCTACCCTAATCTAACCCTGACCAACCTGTCTCCAAACTTACCCTCCATTACCCTACCTCTCGACTCGTTACCCTGTCTCATT
CAACCATACCACTCCCAACCACAATCCATCTCTCTACTTACTAGCACCAACCCACCGTCCACCATAACCGTTACCCTCCAATAACCCAAAGCCAACTCTA
CTACCATTACCCTACCATTACCCTACCATCAGCCATCTGCTACTCACTATACTGTTGTTCTACCCTACATATTGAAACGTTAACAAATAATCGTAAATAA
TACACATATACTTACCCTACCACTCTAATCCCACCACCACATGCCATACCCACCTTCACTTGTATACTGATATGGCATACGCACACGAATGCTACAGTAT
ATATCATCTCAACTTACCCTACTCTCACATTCCGCTCCATGGCCCATCTCTCACTAAATCAGTACCAAATGCACTCGCATCATTATGCACGGCACTTGCC
TCAGCGGTCTATACCCTGTGCCATTTACGCATAACTCCCACGATTATCCACATTTTAATATCTATATCTCATTCGGCGGTTCCAAATATTGTATAACTGC
TCTTAATACATACGTTATACCACTTTTACACCGTATACTAACCACTCAATTTATATACACTTATGCCAATATAACCACAAAATCACCACCAAAATCACCT
AAACATAAAAATATTCTATTCTTCAACAATAATACATAAACACACTCAATTGCGTATCTATACCACCATGACGTCATTAACGTAAAAGTTCCTTAATATT
ACCATTTGCTTGAACAGTTGCCACTTCAGAATATTTCGTACTTACACAGACCATACATTACAATAATATGCCACCTCACTATTGTAACACTCCTCATTCA
CCGAGAAACAATATGGTAGCGGCTCAAACTCATGCAGGTGCTATGATACAATGGCATCCTATTTCCATTCTCATATGCTAACCGCAATATCCTAAAAGCA
TAACTAATGCATCTTTAATCTTGTATGTAACACTACTCATACGAAGAGACTATATCTAAAGAAGACGATACGGTGATAGGTTTGTTGTTTTTGTAGGAGT
TGTAACGAAACGCCAAATAATTCTACGGTAATATAACTTATCAGCGGCGTATACTAAAACGGACGTTACGCTATTGTCTCACTTCGCCTTGCCATAATAT
TCCATACCCATACCGACACCACATTAACCACTGTATGTCGCAAAGTCATCCTAATACCATCCATTCAACCCATTATAATATAACCACAGAACATATTCAC
ACGGATGTAACTGTCTATGTTACCATTGCGTGACATTCCTCAAGCTTACATATTTCTGGCCCAAAACATTGGTCTAATGCAGTATCTAACAGTAGTAATA
GGCGGAAGTACATGGTACAACCAAAAAATTGTAAATGCTTGTAGAGAGTAGTCGGTGAAATGCTAATGTAGTAGTGCACACTTCGGCTTTACTTCCAGTT
GTATGGACTGAGTCGCCTATGAGCACCGTTTTTTTGGGACTATAAAATTTTGCCGAGTGAGCCAGATAAAAAAAATTGGGAACTATCTTGATGCTCCTTT
CTAAGAATGCGGTACAACAGAGTTTTAGTCATTAATCACCTGTTATTATTATCTCTTTTCCATTATAAGGTTACTGAGCCATCAACAGTTCGTGGTGCGC
GCCCGCTTGGCGGGTTTTTTTTCTTTGTTTTTCAAATTATATAAGACTGGTCCTCAGGGGCTCTAGGTTCAAGTAACAAGTCCCTCGAACTATCATCTCA
TCGTCAAAATGAATGACAATGAAGTTAAAGATGAGAAGAGTGTAGATGTGTTCTCCCTCAAACATCTCGAATCTCAAAAGATTATCCTACCTCAAGATCT
TTTCAGGAACTGCTTCACATGGATGTGTTATGAGATTTACAAGTCCTTGGCGTTTCGTGTCTGGTTGCTATTATGGTTGCCACTTAGTGTTTGGTGGAAA
ATGTCCTCCAATTGGATTTACCCGTTTATTGTTTCGCTTTTTTTCCTGTTTCTAGCGCTACTATTATTGCCTGTTATTCATTTACTTTCCCGTAAACGTG
CCTTATCAAAACAGCTCACTCAGTTTTCCAAAGAAATTGCTAAAAATACACCAAGCACGGAGACTCATGATTGGGAGACTGTTGCAACAAATTTAAATTT
GTACCTTTATGAAAACAAAGCTTGGAATACTAATTACTTTTTTTTTAATGCTGCGGACTGCCAAGAAGCGTTCAGAAGAACTCTTCTCGAGCCATTCTCT
TTGAAGAAAGACGAAGCTGCGAAGGTTAAGTCATTTAAAGATTCCGTCCCTTACATCGAAGAGGCCTTGCAAGTTTATTTTGAAGAAGTTGACAACCAGT
GGAAGCTGTTTAATACTGAGAAAGCATGGAGCCCTGTCGGCCTGGAAGACATTCAGCTCCCCAAGGAAACTCACCGATTTAAGCTTACCTGGATTCTCAA
GAGGATTTTCAGTCTCAATTGGTTGCTTCCCTTTCTTTCTTTTTTGAACTGTGTCTACCTGTCACGCAATTTTTGCCCTTTATTTCGTATCTTGTATCTT
GGAGGGGTTTTTTTCTCTATGGTAAGAGGTTTCCAAAATACGAGGATTTTATTTATGAAAATGGAGCACAAAATGCAGTTTTTGTCAACTATTATAAACG
AGCCGGAAAGTGGTGCTAATGGATGGGATGCAATTGCAAAGAAAATGAATAGATTCTTGTTTGAGAAAAAAGCTTGGAAGAACGAAGAATTCTTTTTCGA
TGGAATTGACTGTGAATGGTTTTTTAGCCATTGCTTCTACCGCCTTTTATCTTCAAAGAAACCTGACTCATCTGTATCATTGAATGTTGAACTATGGCCA
TACATTAGAGAAGCACAGTTATCCCGCAGTGAGGAGCCCTTGGTGTAGAAACGAATGCGCCTTCTTCAATTTGTAGTTTGTGTAATTTATCCGACCTGAC
CAACCAAATTTATTTTACTGGTTTACTATTATGACTGAAAGTTATAGAGTTACTATAGGGAAATATGAAACTGAAAGTTCATTTACTGTGGAAGGTTCCG
AGGCCATACCGTTGTCAACAACAAGTTCACTTACATTGTGACCGCGTTTTTCTTTTGGAAAATTCATCTTCGTGATATGAAAATGGTCTCTTCTCATTGC
GGAGCTATGTATTACATCCCGATAGCGATGGTTGTGAACGGCCGAGCGACTTACCGCAAGTGGTACAGCCTCCCAGTTTGGATATGATACCTTGCAATGA
GACAATATTTTTCTATCTTTTTTTTCACTTCTTGGCGAAGAAAGGAATAGTCGACGTCAAGAATGTTGATGTTGGTAACGTTTGTATTGAAGCCAATAGT
CGTACCATTGAGTTCCGTTATAGTTGGGCTGACAGCAACGTTCGTTTGCTGCAAACCATTGGAGTCTACAACGAAGTTAGGATACTCATAAATCTCGCTC

758,844bp truncated ...