Sign In

GLBRC Y22-3 ( GCA_001634645.1 ) - CM004304.1
Saccharomyces cerevisiae strain GLBRCY22-3 chromosome XI, whole genome shotgun sequence

>CM004304.1 Saccharomyces cerevisiae strain GLBRCY22-3 chromosome XI, whole genome shotgun sequence
AAAAAAAATGAAAATGAAATCCTGTTCTTTAGCCCTACAACACTTTTACATAGCCCTAAATAGCCCTAAATAGCCCTCATTTACGTCTCCTCCAAGCCCT
ATTGACTCTTACCCGGAGTTTCAGCTAAAAAGCTATACTTACTACCTTTATTTTATGTTTACTTTTTATAGACTGTCTTTTCATCCTACTCCTTCGCACT
TGTCTCTCGCTACTGCCGTGCAACAAACACTAAATCAAAACAGTAAAATACTACATCAAAACGCATATTCCCTAGAAAAAAATTTTCTTACAATATACTA
TACTACACAATACATAATCACTGACTTTCGTAACAACAATTTCCTTCACTCTCCAACTTCTCTGCTCGAATCTCTACATAGTAATATTATATCAAATCTA
CCGTCTGGAACATCATCGCTATCCAGCTCTTTGTGAACCGCTACCATCAGCATGTACAGCGGTACCCTCGTGTTATCTGCAGCGAGAACTTCAACGTTTG
CCAAATCAAGCCAATGTGGTAACAACCACACCTCCGAAATCTGCTCCAAAAGATACTCCAGTTTCTGCCGAAATGTTTTATTGCAGAACAGCCCTATCAG
CATCGACAGGAATGCCGTCCAATGCGGCACTTCAGATGGGGTAACTCCAGCGCAAGCTGATCTCGCAAGTGCATTCCTAGACTTAATTCATATCTGCTCC
TCAACTGTCGATGATGCCTGCTAAACTGCAGCTTGACGTACTGCGGACCCTGCAGTCCAGCGCTCGTCATGGAACGCAAACGCTGAAAAACTCCAACTTT
CTCGAGCGCTTCCACAAAGACCGTATCGTCTTTTGCCTCCCATTCTTCCCGGCACTTTTTCTCGTCCCAGTTCAAAAAGTACTGCAGCACCTCTGTCTTC
GATTCACGCAGGTTGCTCCATACTTTATAATACAACTCTTTGATCTGCCTTCCAGACATGCGGAAAACTTGGCTCCCTTGCTTGCCTCTTGTCGAATCCA
ATACACTAATTGTTTCTCTTCTTCTAGTAATGGCCAGGTACCAAGCATAATTTCTCTGTATCTGAGAGTAGATCTCTCCCCTTTTTACGCTAAAAAATTT
CAAATACCCTACAGGGTCCCCATGATATGGCTCGATGTCTTCCAAGTATTCTTTGTATTCCTCGTCATTTCGCAGCATTCTCTCCACAGCTAGTGCTTCC
CAAGCCATCCTCCGATACGATACTTTCTGGCCAGCCCAACAGACACAGAGCTCGAACATCTTTTGACAGCCCTTGCATAATCCGTATTGTGTGAATACTC
CCTCTGGGCAGAAGTATACGTCAATACCATAGAGGAAAAGATGTTTAATTTCGTCAGACCGAAATCCAAGAAACTGTAAGACATTCATATTCTCGGAAGT
ATTGGGAAATTGTGCTTTCAGTTTCTTTCTCTCTAGCAAAACCATTTGACTCCCTTTCCGCTTATACGACTCTTTGTTAATGTCGGTGACTGGATGGAAT
CTATTATCCTCAGCATTGCCATCTTTATTGGCGTCCTCCTTGGCACTAGCGTTGGTACTTTCAGTGGTAGTAGCATTAGTGCTGGAGTTGGTGCTAGCAG
TGGTAGTAGCACTAGTGTTGGAGTTGGTACCTTCAGTGGTAGTAGCATTAGTGCTGGAGTTGGTACTTTCAGTGGTAGTAGCATTAGTGTTGGAGTTGGT
ACTTTCAGTGGTAGTCGCACTAGTCCTGACGTTGATGCTGGCAGTGGTAGTAGCATTAGTGCTGGAGTTGGTACTTTCAGTGGTAGTAGCACTAGTGTTG
GAGTCGGTACTTTCGGTGGTAGTAGCACTAGTGTTGGAGTTGGTACTTTCAGTGGTAGTCGCACTAGTCCTGACGTTGATGCTGGCAGTGGTAGTAGCAC
TAGTCCTGACGTTGGTGCTGGCAGTGGTAGTAGCATTAGTGCTGGAGTTGGTACTTTCAGTGGTAGTCGCACTAGTCCTGACGTTGATGCTGGCAGTGGT
AGTAGCACTAGTCCTGACGTTGGTGCTGGCAGTGGTAGTAGCATTAGTGCTGGAGTTGGTAGTCGCATTGGTACTGGCATTAGCACTACCATGAATGCAC
GTGTCGCTGTCCTCATCACTGCTGCAATACTTTCTGCACCTGTCACTGCTATTGCTCTCCTGGAAGCTAGACGGTAACGCAACGATCGACATGGAAGCTG
TCGCCTGTTTTTCAGCCAATCTGTCCATTCTTTCTATCAGTTCCACTGTGTCAGCAGACAGGTCTGTCCTGGAGCCACAGCATCCAACATGCTGGCCCTT
TTTTCCTTTCTTTGATTCAAGTCCATAGAACTCGCGTACCTGTTCGGTTATACAGCCTTCCTTAATCGGTGGTAATTCACCCTTACGATTCCTTGCCGCC
CAACTGTTTTTTCTAGATAATAGATAACAGAGGCCCCCATCTCTTAGTCTCCCTACGCCTTGAATGAGCTCAATAATATTAAGTCTATTATCAAGCATGA
TCACCATCATCAATTGCTTAATGTCAATTCCTTCAGTCACTAATTTCGTTCCGATGAGAACTCGCATGCTACCGTCAGTGACAAACTCCTTTGTGCGAGA
CACCTTTTCTGCAGCACCCAGCTTCCCGTGTATCCATACCACCCTAAAATACTTTCTCCAAGAGCAGGCCAATTCTTCCACTTCGTTGGTTGTGCTTGCA
ACTACAATGGCCTTCGACTCTGGTTCAATTTCAAAGAGGGCTAAAAGAAGCTTCAGTGCTTCTTCGGGCTGTGATTCCACTTTCTTCCAAATTTTATGAA
CATGCCCTAAAGGCACCTCGGATTTCTCCTTGATTAGATTAAACATCCGTGTTGGATAGCTGGATAGACCTCTGCTGAGATCTTCCGACCGTTTGAGCTC
GTTGATGTCCATCGACTTCTTGGCCAGTCCCGTAAGCCCAATACGCTGCAACGCAGCATCAGCTACAGCCTCAGGTGCTGTGCCGCTCAAAAAGATTGCT
TTCTCAAAAGCGTCAAAATCAAGGTTAGTTATGCCCCCAAATTGCGACTGCCGGTAGACCTCCGTTTCAAAGTTGTGAAACTCATCTACAATGAGGTAAC
CCAATTTTACGTTGTTGGTCCTAAAGGTGCACTCAACAATATTCTCCCACGCAGCTATCCTGTCTGTGAAATTAGTGCTAGCAAGATCATCGTAGATCCC
CACGTATAAATCAGTAACGCCATCGCAACCTTCTTCAATAAAGTTTCTTACAGGGGCCACATTCAAGCAACCGCATCGGCCCAACCTGATCATGCAATTA
GCAAGCAACACTGTGTACGGTACAAACAGAAACGACACATATTTCACGTCGCCCTTAGACGCCAGTGCTATCAAGGGGAGATGAAATAACTCCGTCTTAC
CATAGCCCGGTGGGGCCTGTACTGCCACAGAGGGTGTGTCTGCCATGTATATTTCATGACATAAGCGCAACTGATGCAAGTCCCTGAATTCAAAGGAGCT
GCCAAAGAGTTTCTGGCCTGCGACGAGGATATCGTTTGTACTCTTGGGCTCTCGGGGCCTTTTTCGCGTTACTCTTGAAATTTTTTGATCATGATCTGAA
CTCGCCGCCTCACCTGCCACTACGTCTTCCGCATTCCGAGTACTAGAGAATGAACAATGGTAGTCGCTTTCAAGGCCTAACCATTGAATCCAGCGCTCGG
AAGTGAGTCCGTCAAGCGTCTTTAGTCGAGGCTCCGATGAACCGTTCTTGTTGTATCGTCGACGTATACGTTGCGCTGTAGCTCTGGATAACGGTAAGCG
TATCACCGTAAGCTCGTCAATTATTTTTGAGAGCCGCGGTCATTTTGTTAGTATCTCTTCTCAACTTGGGCAGCACACATGCAAAACATCACCCAATCGG
TCCTTTTTGTTCATCATATCGTTACATATCTGTGAAAAGTACTTTATCTCAATGGGTTTACGTGGGCATAGATCACGCTTCAGCCGCTCTGTGTCGACTT
TCTTTTCGCCAGGTAAACTTGCTTGGTATGCAGAAAAAATCGATAGCTCATCTACGTGTAGTAACAAAAACATGTGGGGTGCCAAATTGTACCCATATCT
CCTTATGGTGCTTTTCTGAAGACTCCTTACAATAGGTGCGCCAGAAACAAAGTCAGTGAAAGTACGCATCGTAGAGCTGTCGTTCGGCCTGGCACTCGCT
ATTTCGTGACAACGTTCCAGGACACGGAAACTCAACTCATTATAGTATCCTCTGTTGAGGTAAAAAAGAGAAAGGGTATCGTAATCCTTTCTATTGAATT
TCAAAGTATGCACTTGAAACAACGTGTAGACCATCAAGTTGATTTTCTTGGGAATAAGATACTTTGAAGGGATTGGTCCGCCCTGGAAATCTGGTTCGTC
TTCAACAAACGTCAGGAACTTTTGTACATTTTTCCCGACCATGACGGAAACGACAATTTTTTCAAAAGACCTTTTCCTATCCATTGCACCAGTTCTGAAT
TTTACCACTTTGATTAGGCCAGACTTTTCGTCTTCGTAGAATGACCGCACTTCCGTGGGGATCGATTCAAATAAAGTTATTGAGGGACAATGTACCAAGT
CGTTTTTGTTATTTAGAGCCGACTCAAACTCGTCAAAGTTTGCTTTTTCAAACTTACGCCTATCGGAAACTTTCATTTTATTTTTGTAAGTTTCGAAATT
AACAATAGTATGTTGATTGTTATGCTTTTTGACAAGAAATCCATCAATATAAACAAAAGATTGTCCAGTTTCCGTCTTATCATCATCTAAGAATGTAATA
ATTAAGCTACTCTATTGAGAAGAAGCAGAATCTGCGCTATGCAGGTGCAAATCTCCAGCAGCAGCAAAGAAAATTCAGTTAATAAGAAATCTCACTAAGA
TAAGCGACTGTCTGTCCCAACATAGAAAACAGAAGGATGTCTCATTCATCCTTGATTTCCGGCCTGCAAAAATAAAGTAGTCGGTACGTACGTTCGTTTT
CAATTTCCATGGTGCACAGTATCTTAACTATCTGCTTAGTCGAGGAGAACCAGGATTCTGTTCGTTGCTCAGCCGCTTCGTGGATATTCTCTTGGATACT
TTAAATATGGACCTACGCTTAGCCTGCGCTTAGCCTACAACTTCTTCCGCTCTCGAAAAGACCAATATAATAGAAAGTTATAAATTACATTTCCTTATTA
GGTATACGACCTCGCGCTTCGAAGTAGAGGAGCCCTTTTTGGCGTACCTACATATGGCGCGTCAGACAGACAAACTTCCCCCAAAAATGTATTACCCTGC
CGAATAAGAAAACAGACCCATTCACCCACGACGTATCAAGTTACTTCCTTGGTGCAATGTCCCACTATAAAAAAATTCCTTGACGCTAGATCGTTGGACT
AAAATCTGCGTCACAATCGCCTAAACAGGAAATATTGCCTATTTTCGTACAAGGTTACTTCCTAGATGCTATATGTCCCTACGGCCTTGTCTAACACCAT
CCAGCATGCAATACAGTGACATATATATGATAAACCTGTCTCTTAACCTACCCTCACATTACCCTACCTCCCCACTCGTTACCCTGCCCCACTCAACCAT
ACCACTCCCAACCACCATCCATCTCTCTACTTACTACTACCATCCACCGCCCATCATAACCGTTACCCTCCAATTACCCATATCCAACTCCACTACCATT
ACCCTGCCATTACCCTACCATCCACCATCTGCTACTCACTGTACTGTTGTTCTACCCTCCATATTGAAACGTTAACAAATAATCGTAAATAATACACATA
TACTTACCCTACCACTCTAATCCCACCACCACATGCCATACTCACCTTCACTTATATTGATGGGGCATACGCACACGAATGCTACAGTATATACCATCTC
AACTTACCCTACTCTCATATTGCACTCCACTCCATGACCCATCTCTCACTAAATCAGTACTAAATGCACCCACATCATTATGCACGGCACTTGCCTCAGC
GGTTTAAACCCTGTGCCATTTACCCATAACGCCCATCATTATCCACATTTTAATATCTATATCTCATTCGGCGGCCCCAAATATTGTATAACTGCTCTTA
ATACATACGTTATACCACTTTTGCACCATATACTAACCACTCAAATTATATACACTTATGCCAATATAACCAAAAAATTACCACTAAAATCACCTAAACA
TAAAAATATTCTACTCTTCAACAATAATACATAAACACACTCAATTGCGTATCTATACCACCATGACGTCATTAATGTAAAAGTTCCTTAATATTACCAT
TGCTTGAACGGATGCCATTTCAAAATATTTCGTACTTACACAGACCATACATTAGAATAATATGCCACATCACTGTCGTAACACTCTCCATTCACTGTGC
TATAATATGGTACTGTGTTCACACTCATGCGGGTGCTATGATACAATTGTATCCTATTTCCATTCCCATATGCTAACCGCAATATCCTAAAAGCATAACT
GATGCATCTTTAATCTTGTATGTGACACTACTCATACGAAGAGACTATATCTAAAGAAGACGATACAGTGATATGTACGTTGTTTTTGTAGAATTATAAT
GAAACGTCAAATAACCCTACTATATTATAACTTATCAGCGCCGTATACTAAAACGGACGTTACGATATTGTCTCACTTTATCTTACCACCCTCTATCTTA
TTGTTGATAAAACACTAACCCCTCAGCTTTATTTCTAGTTACAGTTACACAAAAACTATCGCAACCCAGAAATTTTGATATTTTACGTGTCGAAAAATGA
GGGCCTCTAAATGAGAATCTGATACCATGACTTGTAACTCGCACTGCTCTGATATGCAATCTTGTTCTTAGAAGTGACGCATACTCTATATGGCCCGACG
CGACGCGCCGAAAAATGAAAAAAGAAGCAGCGACTCATTTTTATGGAAGGACAAAGTGCTGCGAAGTCATACGCTTCCAATTTCATTATTGTTTATTGGA
CACACTCTGTTAGCTTTATTACCATCCACTCTCTTTCTGGGGTAGCGTAAAAGTTTCTTTCTATGTTTATCATATTCATAAAATGCTTCACGAACACCGT
CATTGATCAAATAGGTCTATAATATTAATATACATTTATATAATCTGCGGTATTTATATCATCAAAAAAAAGTAGTTTTTTTATTTTATTTTTTCATTAC
TTTTCACTGTCTATGGATTTTCATTCGTAAAGGCATCACTCCCTAGTTTGCGATAGTGTAGATACCGTCCTTGGATAGAGCCTTGGAGATAGCTGGCTTT
AATCTGGTGGAGTACCATGGGACACCGGTGATCATTCTGGTCACTTGGTCTGGGGCAATACCAGTCAACATGGTGGTGAAGTCACCGTAGTTGAAAACGG
CTTCAGCAACTTCGACTGGGTAGGTTTCAGTTGGGTGGGCGGCTTGGAACATGTAGTATTGGGCCAAGTGAGCTCTGATATCAGAGACGTAGACACCCAA
TTCCACCAAGTTGACTCTTTCGTCAGATTGAGCTAGAGTGGTGGTTGCAGAAGCAGTAGCAGCGATGGCAGCGACACCAGCAGCGATTGAAGTTAATTTG
ACCATTGTATTTGTTTTGTTTGTTAGTGCTGATGTAATCTTAACAAGAAATAGTGAAATGAAAGCGCATACCTCAAAGGCATATAGTTGAAGCAGCTCTA
TTTATACCCGTTCCTCCATCTGTCATCACTACTTAAACGATTCGTTAACAGACGCTCATTTAGCACCTCACATATTCTCCATATCTCATCTTTCACACAA
TCTCATTATCTCTATGGAGATGCTCTTGTTTCTGAACGAATCATACATCTTTCATAGGTTTCGTATGTGGAGTATTGTTTTATGGCACTCATGTGTATTC
GTATGCGCAGAATGTGGGAATGCCAATTATAGGGGTGCCGAGGTGCCTTATGAAACCCTTTTCCGTGCCTGTTAAGTTTCCGTTTTCGGTCAAAAAGAAT
ATCCGAATTTTAGATTAAGACCCTCGTTCAGAAGCTTATTGTCTAAGCCTAATTTCTGTCTGCTTTAAACGGCTTCCGCGGAAGAAGCATTTCTATCTCT
TGAAATCCGTACAAGATATTAGACGTGTGTTTGGAGTCGTATACTGTTGGCGTCTGCAAATTTGTGAATTCTCCGCGAATGCCTTGGTGCAATTACGTAA
TTGTAGCCGCTGAAGGCGGATGGTATTGAGAGAAGTTGATGTTCAAAGTATCGTGTATGATAAAAATAGAATTGTAAAAGTTTATAAATACTATACTTTA
CTTGAAAAGTCTTTTAGTCCGAAAATGAATGTGGGAATACTAATTACAAGCCTCCCGTGGCACTTCTTCATTTCCTTTTGACTACGAATATGGCACTTTT
TCAATTAATTATATTTAATAAATATTTCTTTTTACTTAAATTTTACAAAACCCAAGATAATTATGGTGATGAAACTACAGTATATATATGTATATGTTGA
AGAGGTTTCAATTCGGCCAAAACGACAGTACTATAGCTGAGTCTGCACTAGACAATATTGAATTCACTTACCAATTAGCATTAATATACCAGAAAAATAT
CGAATTTCTTTTTCCGGAATAAAATACTTCTCTTTTAAAATATTCATTTGCACATTAGAATACATAGGATATTATGATGTGCACCTAAAATGTAGAGAAA
CATACCTAGAACTTACATATCAAACGTCATCTTAGTTATTAAAAATGAAAATAGCTGGGCAGTGACACCTGAAAATACCCCAAAAAAAAAAAAAACAACT
ATCTAGAAAAGTATGTAGAAGTTCAAAAGGAACAGAGGGTGCCACCAATAGCTTTCACAAAGAGTTCCTTTCGTGTTGGCAAAAAAAATGAGTCACTTAC
TACAGGTTCATTTTTATAATTCAATTGTTGTACCTATCTGGAAAAGAAGTCCTCAAAATTACTCCACCCGGAAATAGCTGTATCAAAGAAGGCACTTGGA
GAACCTAATATATCATCGATGAAATTTTCTGAGAAATCTTCTAAAGGTCCCTCTAAATCATTTAGTATGGATGTTAAACTGTTTTCAGTTGCATCATTTT
CGGTTTCAGGCCCTTCATCGATATTTCTCATTCCTTTGTTAAAAGCTCTTCTTCCTATTTTTTCCATTGATATAATAATAGAAAAGTAATAGGAGTTTTG
CCAAATTTGAGTAAGAGGTTTCAACTTTTCTTGGTGAATATGATCAAATATGTTTTCCATTTCTTTAAATGCAATTTTCAGTGAAATACACTTATTGTGT
GGACCCTCAAAGTCTCCAGGACATATAGGATAAGTTAGTGCGGACGAATTTCTCTGGATGAATAATTGGATATCTTTATTTTCCATATACTGTAGAAATA
TGGTATAAATTTGAATTAATGCTCTGAAAGCGTTCACATAAATAAGAAACAACGCATTGTTTAAATGGGGCCATTTTTTGGAGAGGCATAATGACTTAGA
AGATAATTTGCTGTTGTCTAATTCAAAATAGGTCTCAAGGACATTAAAGCACAAATGTAATGAATTTAGTGGAGCCAGGACGCTAAAATTGAATATTCTC
GCATCAAAATCTTGATGTGTTAAGGTATAAAGATTGGATAAACTTCCTATCATATGGAGAGTTGCATGCCATAATTGAAGTTCGGTGAACTCATTACCAT
TTAAATTAGATGCATTTAAGTAAAAATCCAACGGCTTAAACATTTTAATGGTGAACTTTTTTAAGTCCTCGATGATGAGTGGAATGTCAGGCGGTTTCTC
ACGAGCATGAATTTGTTTCATAATATTTCTCAGTCTTAATGTTGTTTTATACAGAAGGATGTCCCCCGATGAAGAATAGTTTTCTAGACGTACCTTGTTT
ACAAAATCGTCGTTGATTCGGACCGGAATTCCTGTAGAGAGTGAAATTTTAACGTCCGTGAATAAGATCCATAACCACAATCTCTCCAAGTAAGGTATTT

684,853bp truncated ...