Sign In

GLBRC Y22-3 ( GCA_001634645.1 ) - CM004305.1
Saccharomyces cerevisiae strain GLBRCY22-3 chromosome XII, whole genome shotgun sequence

>CM004305.1 Saccharomyces cerevisiae strain GLBRCY22-3 chromosome XII, whole genome shotgun sequence
CACACCCACACACCCACACCCACACACCACACCCACACCACACCCACACCCACACCCACACCCACACACACCACACCCACACACACCACACCCACACACC
CACACCCACACCACACCACACCCACACACCCACACCACACCACACCACACCCACACACCCACACACACACACCCACACCCACACACCACACCCACACACC
ACACCACACCCACACACCCACACCCACACACACCACACCCACACCCACACACACCACACCACACCCACACCACACCCACACCACACCCACACACACCACA
CCCACACCCACACCCACACCCACACACACACCCACACCCACACCCACACACCACACCCACACACACCACACCCACACCCACACCACAACCCTAACACAAC
CCTAACACTAGCCTAACACTAGCCTATTCTAACCCTAATTTTACCTGTCTCCCAACTTACCCTCCGTTACCCTACCTCTCCACTCGTTACCCTGCCCCAC
TCAACCATACCACTCCCAACCACCATCCATCTCTCTACTTACTACTACCATCCACCGCCCATCATAACCGTTACCCTCCAATTACCCATATCCAACTCCA
CTACCACTTACCCTACCATTACCCCACCATCCACCATCTGCTACTCACCATACTGTTGTTCTACCCTCCATATTGAAACGTTAACAAATAATCGTAAATA
ATACACATATACTTACCCTACCACTCTAATCCCACTACCACATGCCATACTCACTTGCACTTGTATACTGATATGGCATATGCACACGGATGCTACAGTA
TATACCACTCTCAAGTTACCCTACTCTCATATTGCACTCCACTCCATGGCCCATCTCTCTAACTAAATCAGTACTAAATGCACCCACATCATTATGCACG
GCACTTGCCTCAGCGGTCTATACCCTGTGCCATTTACCCATAACTCCCATCATTATCCACATTTTAATATCTATATCTCATTCGGCGGCCCCAAATATTG
TATAACTGCTCTTAGTACACACGTTATACCACTTTTACACCGTATACTAACCACTCAATTTATATACACTTATGTTAATATAACCAAAAAATCACCACCA
AAATCACCTAAACATAAAAATATTCTATTCTTCAACAATAATACATAAACACACTCAATTGCGTATCTATACCACCATGACGTCATTAACGTAAAAGTTC
CTTAATATTGCAATTTGCTTGAACGGATGCCATTTCAGAATATTTCTAACTTTCACAGACCATACATTAGAATAATATGCCACCTCACTGTCGTAACACT
CTATATTCACCGAGAAACAATACGGTAGTGGCTCAAACTCATGCCGGTGCTATGATACAATGGCATCCTATTTCCATTCCCATATGCTAACCGCAATATC
CTAAAAGGATAACTGATGCATCTTTAATCTTGTATGTGACACTACTCATACGAAGAGACTATATCTAAAGAAGACGATACGGTGATAGGTTTGTTGTTTT
TGTAGGAGTTAACGAAACGCCAAATAATTCTACGCTAATATAACTTATCAGCGCCGTATACTAAAACGGACATTACGATATTGTCTCACTTCATCTTACC
ACCCTCTATCTTATTGTTGATAAAACACTAACCCCTCAGCTTTATTTCTAGTTACAGTTACGGTTACACAAAAAACTATCCCAACTCAGAAATCTTAATA
TTTTACGTGTCAAAAAAATGAGGGTCTCTAAATGAGAGTCTGATACCATGACTTGTAGCTCGCACTACCCTGATCTGCAATCTTGTTCTTAGAAGTGACG
CATACTCTATATGGCCCGACGCGACGCGCCGAAAAATGAAAAAAGAAGCAGCGACTCATTTTTATGGAAGGACAAAGTGCTGCGAAGTCATACGCTTCCA
ATTTCATTATTGTTTATTGGACACACTCTGTTAGCTTTATTACCATCCACTCTCTTTCTGGGGTAGCGTAAAAGTTTCTTTCTATGTTTATCATATTCAT
AAAATGCTTCACGAACACCGTCATTGATCAAATAGGTCTATAATATTAATATACATTTATATAATCTGCGGTATTTATATCATCAAAAAAAAGTAGTTTT
TTTATTTTATTTTTTCATTACTTTTCACTGTCTATGGATTTTCATTCGTAAAGGCATCACTCCCTAGTTTGCGATAGTGTAGATACCGTCCTTGGATAGA
GCACTGGAGATGGCTGGCTTTAATCTGGTGGAGTACCATGGAACACCGGTGATCATTCTGGTCACTTGGTCTGGGGCAATACCAGTCAACATGGTGGTGA
AGTCACCGTAGTTGAAAACGGCTTCAGCAACTTCGACTGGGTAGGTTTCAGTTGGGTGGGCGGCTTGGAACATGTAGTATTGGGCCAAGTGGGCTCTGAT
ATCAGAGACGTAGACACCCAATTCAACCAAGTTGACTCTTTCGTCAGATTGAGCTAGAGTGGTGGTTGCAGAAGCAGTAGCAGCGATGGCAGCGACACCA
GCAGCGATTGAAGTTAGTTTGACCATTGTATTTGTTTTGTTTGTTAGTGCTGATGTAATCTTAACAAGAAATAGTGAAATGAAAGCGCATACCCCAAAGG
CATATAGTTGAAGCAGCTCTATTTATACCCGTTCCTCCATCTGTCATCACTACTTAAACGATTCGTTAACAGACGCTCATTTAGCACCTCACATATCCTC
CATATCTCATCTTTTGCACAATCTCATTATCACTTTGGAGATGCTCTTGTTTCTGAACGAATCATACATATTTCATAGACTTCGTATGTGGAGTATTGTT
TTATGGCACTCATGTGTATTCGTATGCGCAGAATGTGGGAATGCCAATTATAGGGGTGCCGAGGTGCCTTGAAAAACCCTTTTACGCGCGCCTGTGAAGT
TTCCGCTTTCGGTCAAAAAGAATATCCGAATTTTAGATTAAGACCCTCGTTCAGAAGCTTATTGTCTACGCCCATATTCAGTCTGCTCTAAACGGCTTCC
ATGGAAGAAAAATAACTATATTATAGCTTTCCTAAAAGTTTAATTAAGAATAGCAGACATGTGTTGAGAGTCGTATATTGTTAGAATCTGTAGTTTTAGG
TGTTCTCAGTAAATTCATTGAAACAATTGCGTACTTGTAGGCTTCTGAGAAGCAGATAGTAGTCAAATAGTTGATATCTAAAGAGCTGCCGAAGGGGGTT
TCTGTATCCGCGTAAGTAATTTTTTGAAATTTTAATGTGATTTTTGGCGGAATGGCGTGAGTGGTTCACTTCTCATCTTCAATTTCATCGTCTTATATTT
CGATAATAAAACAATACAGTGAGCGTTGTTATTAAGTAAATCATAGGCACTTGGTATCATATAATTCAAAATCAAGTAGTTGTAGTAGTGCGTGTGTGTG
TGTGTGTTAGTAATTGTTGATGGCCTAGTTCATCTCCTTATTGAAAAATGATAAACAGGTGGCAGTTTCAATTGTAGTAAATATTTATTCATTTTTTTAT
TATTGCTAACGTATCTGAAGGCTACGATGTAACGCAGCTCATCTCTTTTAAACATAAAAGTCATTTGTGTAATGTAGAGATTTACAAAGATTTTAAAAAA
ATAACAAAACTATACAAAACTATCTATATTTGAATACTTCCTACTATTTTTTTTTTTTTTAACTATAATGAATGAATGCATGCCATATTGACTTACGTAA
CAAGGTGGCCTATTGGTAATATATTACATATCATCATCCTATATGTGTAGCATAATTTGTCCATTCTTTATCCGCATTCAGGCACTCCCAATCTTTATCT
CTAAGGCAAAGAGCAACCACCATTTCACCTCTGGAGGATCTAGGCATAAAATATATTAGGCTCTCAAGGGGAATGAAGCGCGGCCGACGTACACTCTTGG
GCTTCCCAAGCCCTAGATTGAAATCAACGTCATACAGGCTGACTTTTGCCCACGAACTGACCATAATTCCAGATAAAGTATCAATTGGTTGAGGTATAGA
AACCTTAGTCTTGTCCGGGCATCGGCTAAGGAGCGTAGCAAGTGCGCATGTATTATAGGCCAAATCGAAGACTTTAGGGTCTAGCTTCCTGCGAATCTGT
GATGCAAGAACGCCCAAACTTTTATGATCCAAGCTTTTCAGGGAACCTGTATTAAAGGTCATGTTGACTAATAACCCTGGATACGTTGCGGGGAGTCCTA
GCCGTTTTCTAACATCCACAGCACGCCCTAAAGTTGATTTCGTTTCTGGTTTAAGTCGAGATAAACGGGCTCGAGAAACTGATTTCCAGATGAAAGCAGT
GACGATATCATCAGTGGAGACAAATTTTGTGCCAGAAGTACATGTCTGCATTGCTAAAATCCTCAGATTCTGCAATGAGATAGCAGAAAATTCAACATAA
GCCCAAGTAGAGTTCGAAGAACAAGACTGTTCCTTTTCCTCTCCACTTGTATTTCTAGAGGTTTCCACTATTTCATGAACTAGCGTGGTGTCGGGTTCCC
AAGTTTCATCAAACAAAGGAATAGATTTGCTTTTATCTATATTTCCAATGAATAGTTCTTCATCAGAGAAAGGTTTTTGGTGGCAAGATTTATTGAGCAA
GTTGATGATACTTTCCTGTCCTGTTATATCCATAATATTGTGCTGCCCGACAATAGTTAAGACGAGGCCGCCGGAAATAAAGTTTGCTTGAACTGCAAAT
ACAGGCCCACTCTTGGCGGCCATACCTATAGTGTTTCCAGGTGGATTGATAGTCATGCAAGGCGCAAAAGTCTTTTCGTCTAACATGTAGATAGGAAAGT
CAGCTTTTTCAAGCGAATCCATTGTTGGGGCAGACAGATCTTCTCGAAGATCTTGGACGATAAGTGGAATTTTGTCTGACGGGACAATTCTATAGGTACC
AGTGTTACCTTCGTCAGCACCTTCATTCACGACATTTCCTGCTAGCCACTGGAAATTTTTAGCCAATGTTTCAAGTCCTCTTGTTAAGGTATTTACAATA
TGGTCATGAGCAGAAGGATCTGGTACACGGTAGATAGAGCATATTTGAGTGTATAGTTTGTATAGCGAAGGTTGTTGTCCCAAAATATCAAGTTGATCGT
TTTCTAGCATCTGTACACTTTTTGTACGTTTCTGAGAGATGATCTTGACTCTAAACATCCATCTACCTTCAAAGTGAAATTTATTTTCACGTCCGTCATT
ATGCACGTCTTAAACATTAAAACCTTGATAAGTACACTGTAAAAGCTTTAACGTTATTGGCATAGAAACTCTCATCACTCAGAGACCATCAGTTACCTGC
AAAACGTTTCATATTTGTATATAAACCATGAGATTAAGTGGTCTGAAATTATGTATCATTTTTTGCATTCTAGCATGCCACAGCAAGGGGGTACACATAT
TTTTTGATGGTGAATAAGATAGACATGCATACCGTGATACTTCAAGCTGGCACTATCTTTATATCTTCCTCCGTATATAGCACTTGAAGCTCTGTATCTA
GAATATCCTCTTTAGTCCGGGACGTGCCTCCAAATACTTACGGATTGGCGAAAAATATGCACTGAAATGTGTACAAATTAACCAAAATAGGGCAGGCAGT
AAAAAGTTGTAATAATCCTTCTATTTGATCAAGATAAAATAACCTTCAGCTGAGGACCGCACATTGACGTATATACACTGCTTTTAGTTTTGTAGATACA
AGATATTTGTTAAAAGAAATTGAATTAGGAGTATTTATCTACAGCTGATGCAATTTCAGCGATATCTTTAGGAGACGTTCTACAACAACCGCCAATAATG
CGCGCACCATTATCAACGAATTTCTTAACCGTGGTCTCCCAGCCATCCAACTTATTAGTCGGCCGGTGCCATGTCTTCTCTTTGGGATTGTAGATTTCTC
CACTGTTTGGGTAAACTAGCAGAGGCATGCCAGGTAGATGCTCGTGCAACATTTTAAGAATTAATGCCGATTGATTGAAACTGACACAGTTAACTCCCAT
TAATAAGAGATTCTTGTTAATTTTATTTCCGAGGCCTTTTATATGAACAGAAATTTCTTCCAAAGTGGTACCGTCTCGTAGCAAACTATTGTCATCCACC
GACAACCCAATATAAAAGGGCTTCGAAATAATATCTTCATCCCAGGATAAAATAGCCTTTAACTCATGAAAATTTGGAATCGTTTCAAAACCAATAAGAT
CAATATCTCTATTTTGGTTGAAGTTCTCCAGCTGGGGTTTGAAAAAGCCGTAGTAGTCAATATTCTCAGGATGGGGACCATAGTCACCAGTATATTCACA
GGATACATGTGCTGCCCATGGGCCAATACTCCCGATTAAGTACCTTTCCTCACCAATAAATTCACGAGTAAATGACACGATTTTATCGAGAAAACGCTTG
TAAGCAGCCAGAGTTTTAATCGAGGTATTCTCAGATATGCTTTGAAAGTTTGCCTGGTAAGTAATTGTCATTAATATGTTTGCGCCAGCAATCATAAAGT
CTCTGTACATTTCTTCTACCACCTTTCGCTCTTGAGAAGATGGCTCCCAAAAGGATTCGCTCGTAAAAGGAGCTGCAGACCATACCGGACTATTTATGTT
AATGCCTCTGTTTTCCAATTCTGTACCCTGTCCACCATCAAGGATAAGAACTTTTCCGGGGTGCTCAACTATTAGTTCTTTGATTGGAATGCGCTTCATC
TGTTTTTTGATTACTTTTTCAAGTTGCACACTAAAAATTGCTGATTCAGATTTCTTCTACAACTGGTCTGTTTAAATTATCTTCCTTAGTAGTACATTTT
CAAATTGGCGTTGTTGCTGTTTTGCTATTAGCATTGAATATCTCGCCACAATTTGGTAGTACTTTCATGCCACAGTTTTTACTTTTCCACAGTTCCTGCA
GGAATGGCTTTTTTTCATTAACTTTTTGCGGGGATAGCGAAGAGATGCCAAGAAATAAAGGCGTATATATTTTACAGATTTGGGTGGTTAAGTAATCACC
GTCAAGAGTTCTCCATCAGGATACCATGAACGATACCCGAAATGGATGAATTTGAATCTACCAAACTTTCGAAGGTTCAATTTTCCACCAGCGTGTTAAG
TACGCCTTCGAATGAAGGAAATAATCTAATACACAGATTCAAGAACTCTTTCAAGCGAAATGATTCACCAGCCATCCAAGAAGGTTTGCTGTACTCGGAG
CTTTCAGAGGAAGAAAAAATACAATGGGACTTAGCCAACCAGCCGTATAAAAAGGTCCTAGATCAAAGACACCTGACCATGATAGCCATTGGAGGTACTC
TAGGGACGGGTCTTTTCATTGGTTTAGGGGAATCACTAGCGTCCGGACCTGCTTCTTTGCTAATTGGTTTCTTGTTGGTCGGCGCATCTATGCTCTGTGT
TGTTCAGTGTGGGGCCGAACTTTCATGTCAGTACCCTGTTTCCGGCTCCTATGCGCTGCACGCCAGTAGATTTATAGACCCATCAGTCGGCTTCAGTATA
GGAATTAACTACTTATTGATGTGGCTCATATCTTACCCTAGCGAGTTGGTAGGATGTTCGCTTACCATCTCTTATTGGGCACCATCGGTCAATCCTGCTG
CCTGGGTTGCAATCGCGTTCGTTTTAAGCATGCTATTGAATCTTTTTGGGGTAAGAGGCTTTGCAGAATCAGAGTTTTATATGTCAATTTTCAAAATTGT
GGCTCTATTCATTTTTATAATTATTGGTATTGTTCTCATTGCAGGTGGTGGGCCTGATTCTACTGGATACATCGGCACGAAGTATTGGCACGATCCAGGC
TCCTTCGCTGTTCCTGTTTTCAAAAACCTCTGCAATACTTTTGTTTCGGCAGCATACTCCTTTAGTGGTACAGAAATGGTTGTTTTAACCAGCACTGAAG
CAAGGAGTGTTTCCTCAGTCTCTCGGGCAGCGAAAGGTACGTTCTGGAGAATTATCATCTTTTATATTGTTACAGTGATTATAATTGGTTGCCTGGTCCC
TTATAATGATCCTCGTCTGATTAGCGGTTCATCCAGTGAGGATATTACTGCTTCCCCGTTTGTTATTGCCTTGAGCAATACTGGTGCTATGGGAACAAGA
GTGTCTCATTTTATGAATGCGGTCATCTTGATAGCCGTATTTTCTGTTTGCAATTCCTGCGTTTACGCATCCTCTAGATTGATTCAGGGTTTGGCGACAG
CAGGCCAACTTCCAAAGATCTGCGCTTACATGGACAGGAATGGTCGGCCTTTAGTTGGCATGGCTATATGTGGCGCTTTTGGATTGTTAGGCTTTTTGGT
TGTTTCCAAGAACCAGGGTACAGTTTTCACATGGTTGTTTGCGTTGTGTTCCATTTCATTTTTCACAACTTGGTTCTGTATTTGCTTCTGTCAAGTCAGA
TTTAGGATGGCAATGAAAGCTCAAGGAAGGTCAAAGGATGACATTATCTATAGATCGACATTAGGGATATACGGAGGAATTTTCGGCTGTATCTTAAATG
TTCTATTGGTAATTGGAGAAATATATGTATCGGCTGCACCCGTGGGTAGTCCCAGTTCTGCTGCTAATTTCTTTGAATATTGTATGAGTATTCCCATAAT
GATTGCTGTATATATTGGCCATAGAATTTACCGCAGAGACTGGAGACACTGGTACATCAAGCGGATGGATATTGACCTCGATAGCGGACATTCGTTAGAG
GACTTCGAAGCCACCAAGCTTGAGAGGGATGAGGATAAGAAATACGTTTCCTCTAAGCCACTTTACTATAGGATCTATCGGTTTTTCTGTTAACTTAGTG
AAGTACTTCATTTGAATATTAATTAATAATAATTTTATGAGCCGGGAATTTTGCATCTATATTCTAGGTTTCTAGCAACCGTAGTTTTACGTAAGATGTA
TTTTTTTTTGAATATTCCGTTTTAGAATGATATTCTAGGCCCTGTATATTCTCCAATAACAGCGGCACGTCCAGGTTCTGTGACAATGCTAATATATTCC
TTTTTTTTTTTTTTTTAACTTAGTATACGCTGTATTGGAATCAGTGATTTCATCTAAGTTTACTAACGCTTACACAATTGTGGAAGAAGAGGATAGAAAC
ACCTCAGATCCCCTTGTTACGGTAAAACCCCTATTCTATGCCTCAGTAATAACTAGAAATAGCCGATTATCATTATGTTAAGCCTGTCGATACGCATTAC
AGTTCAAAAAAAAGGCGGACATCGTGGTTGATATTTGTTTGAGGCCTTAAATTTTATTGTATTACATGTATAAATAGCTAACAACATTTGTTCAGTTGGT
ACCAATCACCTTTGTTGCTGGGTATCCGCACACATTAACAAGACAATGGAAAAGGGAGAAAACTAACAATCTTAAACGATAAAACCGGACGAAATAACAG
CTGTTATTTTTCATGCTAGAACTAATGGCTTGATAGTATACTTGTACCTTGTATCTTAGTGCTTGAACGGATGATTCCCGTCGCCCCACACCTATGCATA
CAAGACGTCAATCTTCCTGTGATTATATTTTGAGTATGGCGTAGTAATCCCATATTTCTCGTTGGGTGGTGCTGATATTTGAAAATTCATGACCTGTTCT
ACATACGGCTGCCATTGGTAGGACCGCAATCACAGTGTAATTTTGAAGAACTTACATTGGGCCAATGGATGAGCTGTGACCATAATTTATTAGTTGTTTG
TGTCACAAGCTCAGACTTAGAAGTTCTCTATTGCAAACATTATTTCATGTTTCCTTAAATTTTTTTTATTGCACCAACTTTAGTGACCCCTTGTGAGCTC
CAACATATTTGAAATCTTCTTAAATTTCTAGTCGGCAAGCAGCAAAGAATTTCAGTAGTAATCTCTACCGCGGCAATATCGATGCAAATGTAACTACCTG
TAAGGATATTGTCTTCAGTGGTTTGGTATGGTTTTGTACCTTACTCAACATCACGAATAAAAAGGAAGGAATACGAATCATGATATTGATGTTTAATCTT

1,064,766bp truncated ...