Sign In

GLBRC Y22-3 ( GCA_001634645.1 ) - CM004306.1
Saccharomyces cerevisiae strain GLBRCY22-3 chromosome XIII, whole genome shotgun sequence

>CM004306.1 Saccharomyces cerevisiae strain GLBRCY22-3 chromosome XIII, whole genome shotgun sequence
CCACACCCACACCCACACCCACACCCACACCCACACCACACCCACACACACCCACACCCCACACCCACACACCCACACACACCCACACCCACACCACACC
CACACCCCACACCCACACCCACACCCACACCCACACACCACACCCACACACCCACACACCACACCCACACCACACCACACCCACACACACCACACCCACA
CCCACACCACACCCACACCACACCCACACCCACACACACCACACCCACACACCCACACACACCACACCACACCCACACCACACCCACACCACACCCACAC
ACACCACACCCACACACCACACCACACCCACACCACACCCACACCCACACACCACACCCACACCCTTAACACAACCCTAACCCTAACACTACCCTACTCT
AACCCTGACCAACCTGTCTCCAAAGTTACCCTCCATTACCCTACCACCCACTCGTTACCCTGACCCATTCAACCATACCACTCCCAACCACCATCCATCT
CTCTACTTCCTACCACCAACCCATCGTCCACCATAACCGTTACCCTCCAATTACTCATATCCAACTCCACGACCACTTACCCTGCCATCTTTCTACCATC
CACCATCTGCTACTCACCATACTGTTGTTCTACCCACCACTATTGAAACGCTAACAAATGATCGTAAATAATACACACATACTTACTCTACCACTCTAAT
CCCACCACCACCACATGCCATACTCACCTTCACTTGTATACTGATATGGCATACGCACACGGGTGCTACAGTATACTCCTCTCAAACTTACCCTACTCTC
ACATTCCACTCCATGGCCCTTTCTCACTAAATCAGTACTAGATGCACTCACATCATTATACACGGCACTTGCCTCAGCGGTCTATACCCTGTGCCATTTA
CCCATAAAGCTCATGATTATCCACATTTTAATATCTATATCTCATTCGGCGGCTCCAAATATTGTATAACTGCTCTTAATACATACGTCATACCACTTTT
ACACCATATACTAACCACTCAATTTGTACACACTTATGCCAATATTACAAAAAAATCACCACCAAAATCACCTAAACATAAAAATATTCTACTCTTCAAC
AATAATATATAAACACTTTGACTTGAAGTATGAATACTACCATGGCGTCATTAACTTAAAAGTTCCTTAATATCGTCATACCTCTATACTCTATTCAATA
TATTGTAATATAAATGCACTCTATAGTCATACAGATACTTTCACTTCGCCCTATCTTCCCATACTATTGTCATGGAATCTCACACTGACGCATGATTAAA
CGAACAATTTATACTATAAGGTCTGTCATTTGCGCTCTATCCTTTTGTTTGCAATATTTATATACAGAATCTCAAAACAAGCGGGAGAAGTAGTAATTAC
CCAGAGGTCATGCATGATCTTAGCACCACCGTACCTCTAAGTTTTGCTTTGAGCCTTTTTACAGTGACATCAAACATAAGGAGAAAAAATGGTATTGAAA
GGTTATCAATATAGGGAAATAAATTGGTTCTATGAATCTTCATGTAAGATACTCGTAGGACAGACTCTTTCCTGTGTAAATATTTGTGACAGCTACGTCT
ATTTTCTATTAGATATTTACACAGTTTTGTCACAGCCAATCTGCGCTTAAAATATGTGTTTCAGGCGGCAACTGCTGTACGAGCAGTGACATTGCTGGTC
GCACCTTAAATGTGAACCAACGTTACGGCACACCCTGATGTACTCGCATTAAAGTTTTTTAAAAGTATTATTACGATTATCGAGTGAGCTAGATAGAAAA
TCGGAAATGAAATGGATGCCCTTTTCGAATAGTAGAGTTTCTGTGCCTAAAATAGCCCAACATTGTTGCCCTTTTTCTATCACGAGGTTACTGAGCCATT
GCATGAACGCGCGCGCCTCGGCGGCTTTTTTTTCTGCTGTATAAAAGCGAAAAGCCAGAAGTTACTATCTCGAATAAAAAACCCCTCGAACTGCCATCTC
ACTACCGAAAATGAAAGAGAATGAACTTAAAAATGAGAAGAGTGTAGATGTATTATCCGTCAAACAGCTCGAATCCCAAAAGACTGTTCTACCTCAAGAT
CTTTTCAGAAGCAGCTTTACCTGGTTTTGTTATGAAATTTACAAGTCTTTAGTGTTTCGCATCTGGATGCTATTATGGCTACCACTTAGCGTCTGGTGGA
AACTTTCCAACAATTGGATTTACCCACTTATAGTTTCACTTCTTGTCCTGTTTTGGGGACCAATATTTCTTCTTTTTATTCGTGAACTTTCTCGTGAGCG
TTCCTTATCGAAACAACTCACTCAGTTTTGCAAAGAGATTACTAAAAACACACCAAGTTTGGATACTCATGATTGGGAAGTCGTTGTAGCAAATCTAAAT
TCGTACTTATATGAAAATAAGGCTTGGAATACTAAGTACTTCTTTTTCAATGCTACGGATTGTGAGAAAATGTTCAGAACAACTGTTCTTGAACCATTTT
CTTTGAAAAAAGATGAAGCTGCCAAGGTTAAGTCATTTAAGGATTCTGTCTCTTATATCGAAGAGGCTTTGCAAGTGTATGCTACAGGATTTGACAAACA
GTGGAAGTTGTTTATTACTGAAAAATCATGGAGCCCTGTTGGCCTGGAAGACGTTCAGCTTCCCAAGGATATTCATCGGTCCAAGCTTACTTGGTTTTTA
AAGCGGATTTTCACTATTTACTCTCTACCATTATGGCTTGCTTTTTTGAACTGTATCTGCGTGTCACAGCATTTTTGCCTTCCATTTCGTATCTTGTGTC
CTGGATTGTTTTTCCTCATGATGGTGTGGTTTTTCCAAAATATGAGGACGACTGCTTTACTCGTGAAAATGGAACACAAGATGCAATTCTTGTCGACTAT
TATAAATGAGCAAGAAAGTGGTGCGAATGGATGGGACGAAATTGCAAGGAAAATGAATAGGTACTTGTTTGAGAAAAAAGCCTGGAGGAATGAAGAGTTT
TTCTTCGACGGGATTGACTGTGAATGGTTTTTTAGCCACTTCTTCTACCGCCTTCTATCTGCGAAGATATCTATGTGGCCTTTACCATTAAATGTGGAAC
TATGGCCATACATTAAAGAAGCGCAATTATCCCGCGGTGAGGTGCTCTTAGTGTAGAAATAAATACAACTTTTTCAATTTATATATTGTGTAGTTTGTCA
GGTTCGAATAACCAAAAACGAGGTTACTTTTTACTATTATTTTACTGTATTGATTACAATCCAGCAGTTTCAAACGAGGCTTCTGTTGTTAATCAGACAA
TATGTTGAAAGCTTTACGAAATTCTGTATTGCAAACCCCAACAAACGTACCGCCGCTATTCAAAGTTCCAATTACATTATGAGTTTTATGGTCTCATTTT
GCCACATTGTAAAAATATTTTTTACAGTTTCCACTAGTAATGGATTCCCTCTGAGACAGTGCACTGCTGTTCTTGTCACAAATCCAGCTTTATAATAACG
TACTAGAAGATATCATGACTATAGATGTACTTCTTAAAAATCAATACGTAGAAATATTTAGACAAACCATCTGAAAGCGTTTGTCGAGTTATGAGAGCTT
TGTTTTAAAGAATCATTGAGGCATTTTATATTGAATTTGCAGTCCTAGGTAGAGCTATTATAGGAAAATGCGAATCCAAAAATTTGTTCACTCTAGAGGG
TCTAAGCATGGACGCAAGATAGTGTCGTCGCTGGAAAGTTTATTGATTTCGTGAGCACGCCTTTTTAAACATATTTTTATGATTTAAAGTGTATCTATCC
TTTCCTACAATGTCCCCGCGCCTCACTTAATCCGAAGGTATTACAGTACACTTGTTATCATACGAAAACTTTTGAATCTTCTCATATACCTACTGAACTT
ACTATAAGAAAAAAATTAACTTTTAAATTATTGCTTTAAGATACGCGAGAGAGAAACAGAGTTCGAGTGTAGAAGGTCACACTTAAAAGTTGTATGTAAT
GCAAAAACTCTTCAATTATAGTATTCAAAAATAAACTATTTCCTCACTTTGCCTGCTATTTATTCTTGGCAGATCTTGTACTCATTTCATACACTCTGAA
TCCTCTAATTTGTGGCATTGCCCCTATTATAACAGCTTCGTTCACACTTTGGCCCAAATATTTCTATTACCAGTTCTGAAAAAAGTTTTATATATTATTT
CACAACATTACCAGTCACTTCCATGCGTGCCTTCCCTCTTTGAAGAATTAAATTACTGGCATAAACGAAGAATATCATAATTTTACTTGTAGCTTCTATC
CAATTTTTTTTTTTGCCTTCTTCATACTTTTACTCCTGCTTTTATTACTCTAAATTTCATTTTTATTTATTCTCTTCTACCGTGTCAATTGGACAAAAAA
TTCAAGTTCTGATATCTATGCAGGTCACCCTTTATCAGAAATAAATCTTCAGTCCTCCTTCTTTTAGTCATATCTTAGTAGTTACATAACATACATGAAA
TGCAAGAAAAAATGATAATTGAAGGCCTCCAATTTTCATATCAGGGGTTATGAAAAAGCTTGTTTTTATTAGTCGTTTGCATACTTGAATTTTTTTTGGT
TCACACCAATTTGAAAATTTCAGTCATCATTTTAGCAAATTTATCATGAGAGTGCTTCAGTGCCACCTTTTTAATACGGTGGTGATTAACACTTCGCTTT
TCAGTTTGGAGAAAATCAATTGTCTCCGCTTTTCGTACTTCTATTTTCCTCTTTCGCTTAATAATAATCTTGGCGCACATTACGTAATAGCCAAACCCTA
TTTCTCTCCTCTTTGAACTCGAATTGAAGGGGTTCTTTCGGAATGAAAGAATATAAAAATGAAGGGTTACCTACTTAACTTTTTGTTAGCGGTACCTCTT
TCAATAAAGGAATCTTCAAATAAAAAAATAAAGGCATAGGTCTAAGACTAGAAAAGATCGCATAACGATATGGTATTGGCTAAACAATGGGTTTTGAAAA
ACCTACCAACCCCTGGTGAACCATTTAACTTTCATTTTCACGATCCTGCATGTACTTTCGAGCTCATTGAAAAGGAACTCTCTTCAGAACAATTAAAGGA
CGGTGAATTACTACTGGAAACAACTTATTTATCTAATGATCCTGCCCAAAAATTTTGGATATCATCAATGGACAAAAATTACGCCAAAGGTGTCCAGCCT
GGTGAAATTATTCCTGCAAGAGGAATTGGTAAAGTCTTGGCCTCTAGAAATAAAGCATTCTCTCCTGGCGATTATGTCTCTGCAGTGACCGGCTGGACTA
CACATGCCATAATTTCGCAAGAAAATGTTCAAGGGCTGAGAAAGCTTGACAAAAACAAAGTTGGTAAATTATGGTGGTATCTCTCTGTCTTAGGTGGTAC
GTCTTTAACAGCTTATTTTATTTTCTTTACTTATGCTCAATTGCAAGAAAGAGAAGAGGACTATGGAAAAGTTTACCTAATCTCCGGTGCAGCTGGTGCC
GTCGGTACCGTTTGCATTCAGCTGGCCCTAAACGTTTTTAAGGCTTCAAAGGTTATTGCTATCGCAGGTGGACCAGAAAAGGTTGCTTTTGTTGAATCCT
TTGGTGATAATGTAGTCGGTGTTGATTATAAAGATCCAAGTTTCAAGCAGAAACTTATCGAGGCCGCTGGAGGTGAGAATACCGTGGATTACTTTATCGA
TAATGTTGGCAGTAATGTGTTGGAAGCAGGTGTTCTACTTCTAAAGCAAAGGGCTATGTTGATAGCCTGTGGTGCTATAAGTGCCTATAATGATCCATCT
AAATTTGTCTTTAAGGGGTATAGCTTTATTCTGACTAAACGATTGGTCGTTAAAGGAGTACTAGTGACAGATAATATTGATGATTTTCCAAAGGCATTAG
ATAAATTGGGTTCTCTGGTTAAGCATGGTAAGATTGACCTCTTGAAATCCGCTACCCTTGAAGATGGTACCGGTGATAAGTTCAAGAATGTTCCATTGAT
ATGGAAGGGTCTATTTAGCGGTGTTAATAAAGGTAAACTTATTACCAAGGTTAACAATGAGGAGTGATTTTACACAAAAAGTTTAAGATATGACTATATT
ATTTTTATTATTGTATCTACTTCGTTTTGGCTCTTATAATTTTTTAGTGGCCTAAATTTTCAAAGGAAAAATTTATTGAATATTTTGAATGATATTTAAA
CTCTATATTTTGAAATCTATACATTGAATACATATAAGATAAACTGTGTTGCTCTTATTGTATATCTAGCTTATAGGAAATAGGCTCTCGTGTCTCCTCA
CTAACGTAATCAGCAACACCGATGAATTTATTCCAAAATTTGTATACCTTCATCAAAGATAATTCCCAGATGTTCCTGGGTAAATCCAAATAGCTTCTAT
AAATAAATCTGAATGCTTCTAAAACGTTGTTAACTTCAGTATTCCAAGCTTTCTTCCATTTATTTACTGTACCGTTAGAGGGCCTTGGAACTATTTCTGC
TTTGGGCATTTTTAAATCATCAAATACATGTGATTGAGAATTGTTAGTCTTTTTCTTTCCTTCTTTAGTGGAATTGATGTTCTCTATGGTGTAACGAATC
GATTTGCCTGCCTCCTTCAAAATGTTGAAGAAGTTATTTTGGAAGAATGAGCTTAACCTGTTTTCAGAACCGTTTAACCTTTTCCCGTACATTTTTTCGA
ACATGTTAACAGATTCAATAGATTCAGATAATCTACCGAAAGTCTGTAATAGTGCAATCAACTCATATTTGGTTAACTTACCAACAATATGTTGTTTGGT
GAATTCATCAGCGTCGTTGATTTCAAACAAAATTTTCAAGGCAGTTGCGTAACCGGTAGTTTGAATTTTGCCCCACAATCTACATCTATCACATTGCACA
CAATCCATAATCTTCGTGACATTCTTGAAGCGAGATCTGAATTCGTCCTTCAAAGTCAAACTTAGGTCGTTGGCAAAAACTAAGTCTTCGTTAAAAATTT
TTGTGTCCAGCTGGGAAATAACGTTATCCATTTTGTTTTTGATTTCTTTATTGACTAGATCACAGAATGAAAATTCTGGTAAATATGGTTGAATTTTCCA
GAGAGCCTTAGCTACAACAGCATAATTGAAATACATGTTTGTCACTCTATCAGGAAAGTTCCCGATTCTTGCCATAAACAAATCCAGATTGGGCTCCCAT
TTACCAGTTTTCGTGTTCAAATATTCCTTTGATAAGTGAGTACCGATAGAGGCATGGAAACCGGATACAAGTCTATAAAATGCATCTTTGGCCAATGATT
CACCAGTTTCGCCAATTGTAAAACAGTTGTCTTGGTAGATAGTAGACCAAATTTGACCAGCTTGCTTACCACCATAACCTGTAAATCGTTCCGGATTTGC
TGTTAAATCAATCAGAACGGCGTTTTTACCGTTAAAGTCATTTACATCACAGTAGTTGATGGTGTCTTCGATATCTACAGGTTTTTTACTGGTTTGACAT
AGTTGATCTAAGAACTTACATTCGTCATCGCTATCATCCGCTTCCTTCATTGTATCATTATTGAAACTACCCAAGATCTCAGGCTGCCAGTACTCAGGCA
GTGTATCCCAGTCCTCTACGACATCAACAGAGCAAGCGCGGTTTAAGCACAGACCATCGTTGGCGTCCCAAAATGAACATTGCTTGTATAAATCCAGCCG
AAAGTATTTGAAGAAATCAGATTTTAATAACGCCGAAAGATCATCTCTAATGTTTTCATTTATGGCATTTAATTCATTGAATGTTACGTTACAACTGGGA
CTAACGTGATCATTCCTGTCGACCTTACAAAAGTGAGTGTCATTAAAGGCATTTTGTGTTTGGTCGGTGGCGATGTAGCTATTGTTTGAAGTTGCAGATG
TAAAAGCCGTGAGGCACAGTGTGGCAATGGCGGTTCTTAATCTCATGTTTTACCTGCACGTTACTGTGGTATATGCAATAAAATGCTTACACTCTTGAAA
TAGTATAACCAGTGTAAGTGGTAAACCTTTTCAAGCTCTTTATACTTAGCTTCAAGGATGATTGAACAAGTTTTTATGACACGTACTCCGTATCGTTTCT
TTTTTGTTCTCTTCTTTTCTTTTTGTTCTTACTAATGCCCAAAGCCGGAAAAATGCGAAAAATTTCCAGGGTCTTCTATAAGAGAAACCAAAGGACAAAG
GGAAAAGGACATACTTAGCAGGTAGCTCAATATTATTTGTTTAATTAGAACAGTCTTCTCTTTGTGTATGTCTTGTACCATTGTCTGTGGTATTCTCGAT
TTGTGTAGAATACATTTGCCATAAAATGTCAGTAGACCTTTTCTCTGATACGCAGTGAATATATCAATTCTCCTACATATCCTATTGTTCATTGAAAATA
TGAAAAGTAAGCATTACTCAATAGATAGATAAGAAAATGATCTCGTTTCAGTTGTGAATATGTTTCAGAAGAAATGTCTTGATAGTATTGGTAATGTAGG
ATGGGCAAACCATATGTAAGGTAGGTGGTTGGCAATTTATTTTTTTTGTGTTGCCAGTATGTATATATGCTTTTGGGGGGCCTTAATGTTTACCTTCAAG
GTGCGATATTTAGCAAGCATTTTTAGTTCTTTATGTGGTGAATAAGTAATGTGTATGTGAACTATGGCTACTGGATGACTATATTCGGCATTAGTATTTA
ATAAGGGTACGACTCTGAAGTATCAGAGTTGCATCATTTCAGACACACTGGAGGGATCCTGTTATATATTTTGAAATAAATAATGTACAATTTTAACGGG
TGTACACAGCACAAAAAGGAACGTATTCTTACCGCCGTGTTCTTTCCATCACGAAAGTGACTTCATTGCGATGTATTTTTCAGCAAGAATTAAGGTAATA
AGATCTCTTCACAAAGCTGACTCAAAAGGCCTACATAATGGCAGTAAGAAAAAGTAAACAGCGAGAAATAGTCAGATAAAAAACTAGATGGCGAATAGAC
GACATTTTAGAAGAAAAGTATTTCAGCCTTTGGCCTCAAACCTCAGTGGCAGTCTTTCCCCTGATAAGGAATAGGAAGGCATGCAGCGATATATATGTTA
GTTTTGCCTACGGGAATCCGGCAGCAATGTTATTTATTTTTGTTGTTTCTTATGATTTAATTATTATATACAGGTTCGTAAATATTGGCATGATAATGAG
GAGAAGGTGGAACCAGCACACTACGTCGATGGAGGCCCTTAGAATATAGTCCAACACTTAAAAATGTAATCTAGTACTTTTTCTTCATTTTATTAGCACT
GGGTTCTCGCAGTTTACTCGGTAGGAGGTGCAGTAGGACTTTGCAGTTGTTGGTTGTCTTCTTCAAGTGCCTTTTGTTGGGTCACTTGTTGTTCGTACTT
CTTACCGTTCATGTATAAAGTGTAAGCTAAGCCACCCGACATGTATAACGTACCACCAACCAACGTCAGTACCGTTAAACGATGTAATGTATCTGTAACT
CTGGTATACCAAGCGTATTTGGACATGACTATCTGCGTTCTATTTTTTGTTCTATTCCTCTCACCATTGCCAAACCGCTGTATAGATTTATGCTCCTTTC
AATGCATTTATTCTGATCCTCTCCGATTTCGTATACCGGGTAATATTAATCGCAAGGAAGGAGAAGCAAAGCTCAGAAGTAAGGAAGAACTTCGAAATCT
GCTTCCGAGAGTGTGGAAATAGTGTTTTCTAAAGAGTGTATTTCACAGTATGTAACATTATAAAGACAAAATACTTACTTAAGCAAAGTTATATAGAAGT
GACAACGTGTTTTTTTCGTTTTGCTATTTGCTTGTCCATTTTACGGTAAAATATACGGATGAAAAGAAAAATTGGGGAGAAAAGTACATTACGTTGACAC
CCCAATCATTAGTTGAACCCTAATATGCTTTTCGACCAGTTTTTAACGTTATGTAGGTACCTCTTGTAAGCAGGCTCCTTAACAGTGCCGAACAACCATT

902,319bp truncated ...