Sign In

GLBRC Y22-3 ( GCA_001634645.1 ) - CM004308.1
Saccharomyces cerevisiae strain GLBRCY22-3 chromosome XV, whole genome shotgun sequence

>CM004308.1 Saccharomyces cerevisiae strain GLBRCY22-3 chromosome XV, whole genome shotgun sequence
CTATACCCTGTGCCATTTACCCATAACTCCCACGATTATCCACATTTTAATATCTATATCTCATTCGGCGGCCCCAAAATTTGTATAACTGCTCTTAATA
CATACGTTATACTACTTTTACACCGTATACTAACCACTCAATTTATACACACTTATGTTAATATTACAGAAAAATTACCACTAAAATCACCTAAACATAA
AAATATTCTATCCTTCAACAATAATACATAAACACATTGACTTGAAGTATGAACACTATCATGGCATCATTAACGTAAAAGTTCCTTAATATTGCAATTT
GCTTGAACATATGCCACTTCAAGATATGCTGTACTTACACAGACCATACATTAGAATAATATGCCACATCACTGTCGTAACACTCTCCATTCACTGTGCT
ATAATATGGTACTGTGTTCACACTCATGCGGGTGCTATGATACAATTGTATCCTATTTCCATTCCCATATGCTAACCGCAATATCCTAAAAGCATAACTG
ATGCATCTTTAATCTTGTATGTGACACTACTCATACGAAGAGACTATATCTAAAGAAGACGATACAGTGATATGTACGTTGTTTTTGTAGAATTATAATG
AAACGTCAAATAACCCTACTATATTATAACTTATCAGCGCCGTATACTAAAACGGACGTTACGATATTGTCTCACTTCATCTTACCACCCTCTATCTTAT
TGTTGATAAAACACTAACCCCTCAGCTTTATTTCTAGTTACAGTTACACAAAAACTATCGCAACCCAAAAATTTTGATATTTTACGTGTCGAAAAATGAG
GGCCTCTAAATGAGAATCTGATACCATGACTTGTAACTCGCACTGCTCTGATATGCAATCTTGTTCTTAGAAGTGACGCATACTCTATATGGCCCGACGC
GACGCGCCGAAAAATGAAAAAAGAAGCAGCGACTCATTTTTATGGAAGGACAAAGTGCTGCGAAGTCATACGCTTCCAATTTCATTATTGTTTATTGGAC
ACACTCTGTTAGCTTTATTACCATCCACTCTCTTTCTGGGGTAGCGTAAAAGTTTCTTTCTATGTTTATCATATTCATAAAATGCTTCACGAACACCGTC
ATTGATCAAATAGGTCTATAATATTAATATACATTTATATAATCTGCGGTATTTATATCATCAAAAAAAAGTAGTTTTTTTATTTTATTTTTTCATTACT
TTTCACTGTCTATGGATTTTCATTCGTAAAGGCATCACTCCCTAGTTTGCGATAGTGTAGATACCGTCCTTGGATAGAGCCTTGGAGATGGCTGGCTTTA
ATCTGCTGGAGTACCATGGAACACCGGTGATCATTCTGGTCACTTGGTCTGGGGCAATACCAGTCAACATGGTGGTGAAGTCACCGTAGTTGAAAACGGC
TTCAGCAACTTCGACTGGGTAGGTTTCAGTTGGGTGGGCGGCTTGGAACATGTAGTATTGGGCCAAGTGAGCTCTGATATCAGAGACGTAGACACCCAAT
TCCACCAAGTTGACTCTTTCGTCAGATTGAGCTAGAGTGGTGGTTGCAGAAGCAGTAGCAGCGATGGCAGCGACACCAGCAGCGATTGAAGTTAATTTGA
CCATTGTATTTGTTTTGTTTGTTAGTGCTGATGTAATCTTAACAGGAAAGAAAGAAATAAAGATATATTCTCAAAAGCATACAGTTGAAGCAGCTCTATT
TATACCCGTTCCTCTATCAGTCATCACTACTTAAACGATTCGTTAACAGATGCTCATTTATCACTTCACGCCTTTCATATTTCATCTTTCGCACCATCTT
CATCATTAAAAATGAGATGCACTTGTTCCTGAACGAGGCATGCATATATCATGAATTTCTTATGCGAAGGTATTGTTCTATGGTGCCTATGTTAATTCGT
ATGTGGGGGAAGTGAGAATGCCAATTGTAGGGGTGCCGAGATGTGCCTTGAAAAAACCCTTTTCGCGTGCCTGTGATGCTTCCATTTTGGTCAAAAAAAG
AACGTCTGAATTGAACCCTCATTCAGAAGCTTATTGTCTAAGCCTTTATTCGGTGTTTTCTAAACGATCTCCATGGAAGAAATATTTCTATCTCTTGAAA
TCCGTACAAGATATCAGACGTGTGTCGGGAGTCGTATACTGTTGGGGTCTGCAAATCTGTGAACTCTCGGCGATTATCTTGGTGCAATTACGTAATTGTA
GCCGCTGAAGGCGGATGGTATTGACAGAAGTTGATATTCAAAGAATCGTGTATGATAAAAATAAAACTGTAACCATTTCTTAGTGGCAGAATTAACTCTA
CACAGAGGGAAATATTTGATTCCGAGATGCAATCCCCCTTTTCTAGCCAGATATGAAGGAGAAAAGTGAAACGGCAATAGATAGCGCTACTTTATTTTAT
TCTATTTTAAAAAAGTTCTCTAGGAGAAATACATTAATTATTGATACTCCTTGTAGCTTCTACGTCAAAAGAAATGTCTCTATCTTTATGGTAACGGCTC
GCCGTCAGAGCTCAATTGTGCTTCTTGAATGTGTTTCCAAAGTTCAACGTTTAATGATCTAGGCGACAGAGATTTCTTTGAGAACAAAAGGCCACGAAAG
CTCCGTTCAAAGAATGCCTGACAACCAGCCCCACTGAAGAGAAACTCTTTTTTTTTTTCTAAACCCATGAAATACAGTTCCTTTTCCATACCAAAAAATG
AGGAAAGAAGCATGTGTTGGGAGTCGCAGGCAGTTGTAGAGGTTTACAATTCTAACCATTTTTGTGATTCGTTGTAAGTCACCGTTCCATGGTAAACGTA
TTCTTAATTCTGCTTTAAAAAACAGGCACATATGTTATCACTCTGATTTTCGTCATCCAAAAACATATGATAGCAATAATTTTACTACTCGTTGTTGTGC
TGATATGGTTAACCACTCCTTGGAAACACAGGCATAGAAAAAGTAGGACAGATTCTTCTTCATTATGATTTAACTTAACATAAACAGGGTTTTTTAAAAA
GAATTTATTAATGTTGAGGATTTATATTGTATAACATTGGACGGTAGTCAGTATCGCTCAACTTATATAAAAATAATTAGAAATAAGTGAGACAACATAG
GTTTATTGGTATCTGTCAGACTAACGATAAACTTAAGGTTTTATGAGGTTTTGAAGCTTTCAATGCGTAAAATGATCCCAAAAAATACAGAAATTTGTAT
TGCATTCAACATCATATCTAAAAATAACCAAAACAATTTTAATTGTGAAACAGTCACTATTAGCAAAGTAATCAAGAGTTTCGACTGTAGAGCTTATCAC
CAAGTCAGTTTAATTCTACCGGGTCTGTATATGTACAATCTGAAGGGAATTATTACTGACAAAATCGTCCTCTTTTTATCACACTTGGTCTTTTGTAGTC
CACAAGAAATATATGATTTTACTATGTGGTACTTTTTAAGTGCAAAAGGTACACGGGAGCTGGACACTCGCATATTTTTATAAAACTCTCTGTAGTTCTT
AAGCTTCTGATAAGAGCATCAGTACATCTGTTTTTTATCGTATTATAGACACGATTTGAAATCTTTAAACTTTATTCGATTAGTTTGATTCTGATGATCA
TGGACCTTTACCATATGATCCAAAATAAAAATGAAAATTGAGTATAGAGGAATAAACAAACAAGTTATACGTCATAATAACTCAAGTAGAGATCAAAAAA
AAAAAAACTTTACCTCATTGAGAACTCAGAGTAGCTTGTATTTGATAGTCTTTTTATAAGAAGGATTTAAGAATTAAGACGAAGATAATCCTCCAATCAG
CAATTTTATCAGTGTGTGGGTGGGCATTCTGCTAAATACTCTTCAAGAATAAACATGCATGCACAAGAGCTTTAATTTGTTTCTTAATAGAAGAAGTACT
GGTATTTTAAAAATTAGCAATTCTAAAAACATTGCTATTAGACATTAGGGGGTGATTTCTTTCTTGCACGATTCTATATGACAGTTTTGTAGACACAAAC
AAAGGCGACCAAGTTTTGTATGGAAAATATAGCATTCATTTGTCTTCAGAGCTGCACAAAGAGGTATATACGGCTGCCAATTTTATAGTGCTACATTGGA
AAATTATCATAACATATCATTTCCAATATTTCTATTGCAGACCACCTTATTTAATCACTGTATCTCTTTAAACTGGTCTAAAGCTGTGTTTAATCGTATT
AAGAGGCGAAAGTACATGATGGAACTGAAAAAGCACTGTTACAATTACCAGGTGAGTAGGATAGGAAATCGGAAAAAAAATGGGTGCTTCTTTCTAAAAA
TGGCCAACAACAGAGTTTTCTCAGTCAAAAATAGCCCAAGATTATTGCTCTTCTTTATATAAGATTGAATAAGCCATCACATAGATGCGTGCTTTGGTGA
CCTTTTTTTTCCAGCTTTTATTTTAATACGTTCTTGCTTGTATACTATCCCACTTTATATATATTACCTAAACTTTATTATTTAAAGCTCATCATGGTGG
TCATGGCCACCGTAACATTGATTATTAAAGCAGCATCCACTCTCACATCCCTCTTTTTGGGCAGCGCGTTTGGATCCACACCACTCTTCACAACAAACAT
GACCATTCTTCTCTGTGCACGTTTTAATGCATGAATGGCCCTTTCCACCGCAATTGTGTGCAGATGAATAGCCGAGCGATTTACCGCAATCAGTACAACC
TCCAGTCGAGATACGATACCTTGCAAGACACCCTTTTCCTCTTTTTAGCATTTCTTGGTTGACTTGTTTGGCGAAGAAAAGAAAATTCGACGTCAAGAAT
ATTAATTTTGGTAACGTTTGTATCAAAGCCAATGGTAGTACCATTGAATTCAGTTATGATTAGATTGATAGTACCATTGGTTTGCTGTGAGTTTACTGAG
TCGACAACAGAGCTAGCATACTCATGAATCTCGGTCTGATTACTGTCGAGGGTTCCAGCATGAACGCAAGATTATACCGTCGCCAACAAGCTCATTAATA
TCGTGACCATGTTTTTTTGAATTCATCTTCATAATACAAAAGTAATCTCTTATTTTCTAGTGTCCTTTTGGTGATATGTAAAGTATAACAATATATCTTC
TCTTCAAACTGTGAAGGATTTAGAAACTTTATAAAGACAAAGTCGGAGAAATTCTCTTCACAATATACTGTATCCAGCCACTGCCCTGATAAATCGAGTT
CACAGTATTGCATATGTGCAGTGATTCCACAAATGGTATTGATTTGGTCCCAAACCCGACAAAACAAAGAAACTAGCAGCGTATATATAGTACTTATTCT
ATGGGGCTATTCATTTAATATTTAATCTGTCTGACCTGGCATTCTGCAAACTGTCGGTAGGAAATTACGCGATCAATAAAATTCCTGTTAATGGGAGGGA
GAAGACAAGCGAACTCTAGGCTTTAAGCAGAGCTGGTGGAAAAACACCATAATAATCCGAAGCAGCAGTTACGCTAAATGGAAAGAAATCGTTAAAAATA
AGGGGCAGGCAGGTGTGCTGCTGAAAAGGTAAATGAAAACCAGTGAGTACACTTCTGCATGGATTTTTTTGGCAACAAATCAACGAAAAAAATGCTCACA
GTTTCCGAATAAGACGGCTTTCCATCAGTATTATTAGAGAATTATGTGGCTGTAACCTTGCTGTTTTTACACTCGTTCCAAGTAAAAAATGCTCATCTTA
CCATTTTAGATAGAAAAAATAAATCCTACCTGCCTTTTCTAGTCAGCAGAATCTTTACAACATATTGCGAATTTTCTTCAATATTGGTTTATTTTAAGTG
TTTGATAGAGTTTGGAGTTCAATAATTTACGCTTGATTCTTAAGTTATTTTTACTAATGGCACGATAATTAATGCTGCTGTTACTCCCTTATATGATACT
ACGCGGTAAATCATCATTATACGGAAACCTTTAGATATAGTGCTGTCAACTGGAATTATTATATGGGAAATAACAATTTGTGCATTTTGCATTGAACAGC
TCAGGAGAAGAATTAAGTGTAAATTTGGGAGTTTGCACTCAAATCACCGCCCTGAAAGTGAAGCAACAATCTTGAAGCCTGCTGTATTGGAAGCATTGGA
ATATACGTCACTCCCTGAACATCTTGAACCTTTTTTTTATTGCTAGCTACAGCTTCAGTTAATTTTGTCACCTTAGACTACCAATTGTTTTATTTTGTAT
CTTTGGTATGATAATCTTATTCCGTCTCGTATTATACTTGTCCTGTTATGATCTCTCGAAGCAAGTTCTAAGAACTTGTGAGTTTTATAATACTCCTAGG
TTTAGCCACTTTCCAAAGATAGAGCAATCTTTTTGGAATTGAAATGTCAGAGGGATGATTCTGACGATAGACATTTTTCTGATGAACTGTTGCGTACGTA
CGCATAAAAACAGTATAACTTTAGGTGGTAGCGGTAGTGTCGACTTTTATTGGAATGAGAATTAACTATCATATATCGACTAGTATCCATAGTACGTGTA
TATTATCGTATACAACGTAAGAAGACATAAATATTGAGAAACAGTCATCGATTTTAGTAGAGGTTGAAACGCGAGGCTTGATAATTTCATGGGATAATGA
ATGACGGCATATAAGATGAAAGAAGATGTAATAATATTCATTATCATTCAAACTCTATCTCAGCCCGTCCTCATCTCTTTCAGTACTGTATGTGAACTCG
TCCATAAACACCGTATAGCTACGTCCTCTTTCATTTTAAGGTATGTATCTGCTTCTTGCATCACGTCACCACTAGCACAATGAGAGTATACAATACAATG
TCATTAACCCTAGATGCTGTTGTTCCTCGATGTTGTGTATACATACATTAACTCGAAAGTGCGATGTTAATGATGTCCTAGTGCTATATAATAAATCTAC
AAACTAAAAAATCTTGATCACATCAACCAAAAATGTATCTTACTGCTAAATGTGTCATAAAAGGGTTCCAGTATCCTTACTACACCATTATATAGAAGAC
TCTTTATAATTTCTTCCGTCAGAATAATTACTTATCAATAGATTGTTTAACATAGGAGGAGTTGGATGAGCGCAAGCATTTGTTGAGCTATTCGCAACAG
GATGAACATAATGTCCTTCTTCATCATATACACGCATTACCAAATCCATTATATCTGTACAATAATCAGTCTCAGAATTATATGGCTCAGATCCGTTATA
AGTCGATAGATCTAGGTTACTGTACTCATAAGAATCTGTAATAGCCTCCAACTCAACTAAGGTATCCCTATAAATCAAAGATTGCTGATCGCCGGGTTCA
AACCGTCCCGTTCTAAGTGTTCTACCACTTTTATCAGAATCAATATCATAGTAAGATGCTTGGAATAGCCAGCAGATTTGATTGTTTGTCATATTAGTTG
GCAAGTTGAAAAATACTTGGTAACCGCTGGTGATATCAACATATGCGGAGCATAATGAGTACAATTGAGAAAAAATGCAAAATAAACCAAATAAGGGAAC
CATTTTTTATTAAGCTTCTCTACCCTTTTAAAAATGGCTTTGACTTCAAAGGCTTAGGAAGCAAACATGCTACTGCTATTTTTTGTCCAAAATTTTTATC
CTTTATAGTTAATGTTTTTAGATATTGCGCGGATCCATTTAAAAGCAATTTTGGTTTGGTTGCATAATGTTCAGACATGTATTTTAAAAGGTTAAGCGGC
GTGCCTTAAAGCATTTTACTCCCGAGTTTGATCGGCTCGCTTATGCTCACAAGTATATTAAACAAGAATTATGGAGAAAACAAGTCTTTAACGTGTATTT
TTAAATCTATATACATAAACCGCAGGACGCGGCATTCGACTGCTTTGATAAGAATTCAAAAGTTAGTGTCCGGAAATCTATTTTTAGTAAAAGTAATAAT
GTTATTTGTACAGAGTATTGCAGAAGTTCTCTTTTAGAGTGTTATGAATTCATGAAACCGAATCTATAGCTTGCAATATAATCAATGCCATAATACTACT
GTTGAAATAGAGAATTTGGTGAATAATTGGATAATTGTTAGGATTTTCATTATTATTGAAGGCTATAATATTAGGTATGCAGAATATGCTAGAAGTTCTC
CTCAGATATATAGCAATTCATGAAGGATCGTCGATTATTCTATAGAATAGTATTATTACTTCACTTTCCATTTTATATGTTGTGATTCATTATCTTATTA
CATTCCTAATTCTTGAGTGTCAGCTTTCACTAAATTTCATGGCTGTTTCTCTATCTTTATGTCATCTTCACTTATTTCTACACTCCTCAAGATTAAGTAT
CTAATTTTTGTAAGAAAACGACACTGCAAAGAGTGGATCAATATATAATAACATGTTTTAAATAAACGTCTACTTATGATGGAAAACATTAACTTGTGAG
TTAGGATTTTTTGTATATGAGATATTTTAAAGAAAATTTAGTTCCAAAGGAGAAAATGACTTGCACAAAAATGACATGGGCAAAATACCTAATATTAAAT
GAGCTCTATCTACAATCCGTGCAGCTATACATACTTTCACGCTTGTTATACATTAATCAGCGAACCATTATAAGTATGGGGCCACTAAAATTTCATATAT
TCTCTGATCTGAGACTGTTGGAGTCGATTTCTCGCACAATCAGCACTGGTTAAAATTTCGTGGGGTTACTGCGCCTTTTAAGTCGGTCAATGTTTTCTTC
ATTCTTTCGAACTTTGAATATTTTTTATGACGTCAATTATGAGAAGTATGAAAGTCAGGTTAGCAACAGCTAAAACCAAATAATAAAGGGCTCAAGCAGG
CTTACGGCAGGTGGTGATTATATTTACACTACTAATTTTTTTTAATTCGTTTACGCTCTAGTAAAAGTTCTTCGCAACATTTTTTTTTATATTTCTTTAC
AAAAACTGCGGGAAATGACAGGTGCGAATAATCTCATTGATTTTTGTATTGCCAAGCCCATTTAAGACTATAATATTGCTGAAATAAACGTAACAAACGT
ATGGATATTCACTTAGTTAGAAAAGAAAAATAAAATAAAACTAATTCGAACTTTTTATTGTTTTTTATTTCAGACAACAATATCATACTGTTACACGCCA
TTATTGATTACTACTTACATTAACAGTGATTATTTCAAAGAGAATTCTAGTTCAGGAAAGAGCTTAACACTATATTTGCATCGCTAGTACTCTCCAGCTC
AATATCCAATTACACGACGGAGCCATGATTGTTGTTTGATTTTGAGCTTCTCTTTCTCTCGTTCTTCTGCGGAAAGACTTTGCTTCTTGTTTACAGTAAA
GCCACGCAAGAAAAAACAGAGAACAGCATTGAAAGCCGCAAACGAAATCGACACAATTATCAATAAGCGTTGAATCTTCGAATAGGATTCTATCATCTGA
ACACGAACCTCTGATCCAATAGGGTATTTTTTTAGATAATTGAGTGGTGATTTGTAGATTGCCATCCCTAAACTAGAGCCGAGTCGCTGTATCAACTCCT
TTGCCAGACGCTGAGTCCATATAGCACCAGCGATGGAAGCACCTACTGCGTCTCCGATTTGATAAACGGACATTAGTAACCCAGTGACAGTTGCCATCTC
ATTGTGGGTGGTTGAAGCATGCACTAGCGTCCACATAGGAAAACGCATCATACCACCAGCTATACCGACCACAATCTCAGCGCCAATAAGACCCGAAATC
CCGTCATATACCACCCTGTATTTGTACAAAAGACCCATTCCGAGGACACCAAGAAGCGACCCAGCGACTACAAAGACTTTCGGATGAGGATAGAAATGCA
GCATAATGCCGACAACAATATTAGTGCATGACTGTAGAAAATTGTAAAGCTGAGCTATCCGCTGCGCACTTAATGTTGATTCTCCGAATGCTACCATTAA
CACGGTGACCAAATACTCTAACTCAATCTGCAAACCTAGACGCCATACAAATTCCATTAGCAATGCAACGTAGATGGTTGGATCACCTAGATATACTCGT

1,057,911bp truncated ...