Sign In

S. eubayanus strain FM1318 ( SEUB3.0 ) - NC_030977.1
Saccharomyces eubayanus strain FM1318 chromosome II, whole genome shotgun sequence

>NC_030977.1 Saccharomyces eubayanus strain FM1318 chromosome II, whole genome shotgun sequence
ATATTATACTAAATACCCTCACTTTTATATTATAATACACGCACATACTCACACGGACGCTAAATATAATACTCACAACATACAAAACCACAATATTTCT
CTAACTCCTCTCTTCCATATTCTATATTTTTATATTTTCTCACAATTTCTATCCTTTTACCTAATATCCATACCCAACTATAAATCATTAATTCTTACCA
GCACTTCAATTATCGTTTATACTTATCTCATCCACCTCCAATACCACCTGACCATCTATCATCGCAGTTAACCCCATCACTCACTATACCACCACATTAT
CACCATATACGGCACGAACCTCAGCATTTGACACCCTGGACATTTTCACATTCCAACCACCGTCCCGGCCACCAAACTCTGCCCCCCACTAAATACGACT
TTCTACATCCTATATTCGCTTTAAACATCTCAATATTTTCACAATTGCACTTATAGCATCAAATATAAATTATCTTCACCACCTCTCCTCCATCACTACA
ATATACCCTCACATATCAACACATTTCGCAACACTTCCATACAAACTCACATAATATAGACTATATCCTCATTACTGCTTCTTATTATGATACTATAACC
ACCATTCATCTTTATCTATATAATACCATATACCCTCACTATCTCTATACAATCATATACCATCACTTTCCCCCTGATATTCCCTAATATCACACACCAT
ACTATATATCCAGACACCTACTACCATCGCTCTATCATACCATGATTCATCACCCTAACCACTCTCAATAGAATAATGTATCCACATACTCATACGGACG
CTAAATATACTTTCATAACACACCATACTATATATTCAGATACCTATTATCATCACCCTAATTACTCTCGATATCACATCGCTGCCATGATATTATAACC
ACACATCTATATATATACCATATACATAATATCATCACTCTCGATATCACATACCATAATATCATAATACCACCTCTCTCTATATATCATATACCATTAA
GATCCATACGTCCATATGTCACGTACCATATACCCTCACTATTCTTAATACTATACCACCGCATAGCATACTATATATCCAGATATCTATTATCATTACT
ATATATATACCATAACTCATCACCCTAATCACTCTCACTTCCTCTGCCCATAATATCCTCATACCATATTACCATCACTCCCCATATACTCTATACTACC
MCAACTATCATAGAAKAATACACGCACATACTCACACGGACGTTAAATATAATACACACTAATCATCGCAACACTCTAACATTCGTCACTGCCATATCAT
AATATAAACACCAAAAGACTTGTACAAATGCTATATTATATACCCACTACTGACCAATCCCATATTATATCATAATATATTAAATCGCACGCTCACACCG
ACGCTTACATATACTATGACCGTGATATTCATCTGTCCACCCATCTTACTTTATCACTGGATTCTTCTGYGARCCKTAATATCACATCACATCATTACTA
CTATATATATAACATAACATATCTACGCATTAAATAATGCCAAACACTTTCCATATCATTCTACCATTCAAACATATATTTCATTTTAAAAGCAACACAC
ATTCCTACGGACGCTAGAAAATTACATCTCATATTTTACTTTTTCYTCTTATTGTTCCCGCTCACTTAGCTAGCTGCCCAACTAACGCTCGTCCTCGGGG
AGCACGTTCCGACATAATAATGTGACAGTCATGTGACGATGTTCAGCCAGCGCACGCGCGGCCGGGTAGCTAGGGCCGCTTCTTTTGAAAAACAATAGGC
CAGGCCGGGCAACCAGGGCCAGATTTGAAAAAAATTCAACTTAAATCCCGAAAGCGTGCCTTCAAAAAAATGAGTTTCCTGCGCGTTTTCTTAGAAATTG
GGGCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTTCTTTTTGTCCATA
GGCCGCTTCTTTTGCTTTATGAGCCAAGTCCGCCTTTCGGCGGACTGTCTCATAAAGATGTTCACTTATACTCCAAAACCAAAACGACCGCCTCGCCGAC
ATCACACCCATCTTCTGCCTCACTCATCTTACCTTCTCTCATTGTTACCGCGTTACCTAGCCGCCCAGCTGACGTACCCTGCATGTGCGGCTGAACACTT
TTCTCGGGCAGTGCGTGCCGACACGATCATGTGACAGTTATGCTACTATATTTAGCAGCGCTCACACGGCCGGGTACCCAGGGCCGCATTTTCGAAAAAA
TGGGCCACTTAATACCAGATGTTATATATAATGATACTTCTGATAATTCAGTATCGTTATTCCATCACATGCATATAGAAGAGAAAAATAGAAATATATA
TCAAGCTCCTATCATTCTGCTTTTTTGCTTCTGTGTTCATTATGATCAATGCGCAGTCTGATTTTTCTCAAGGCTTAATAACATAAAGAACACCATAACC
AACGATTGCAGTTTTGATTACGCTGATTTCGAAGCAGACGTGGGTGGAAATACTACATACATCACACGTGTAACTTCAGGCCACATTATATCTTATGGTA
GGGACATCGGTTTTAGTATTTACCATCCAGACGTTGCTGGGGTAGTGTCCGTGGAAGACGTGATACAAGCATATAGGGATACCTACAACAGCAACTTCTG
TGCGTACACTAGTCGTATAAGTAATAACTACTTGGTACAGTTTTCGCAGTGGCAGTCGAACATCTTTAAGAGATTGGACCTTGTCCCAGATGACATGATT
CCGTACGACCACGTTGCTATAAACAGCACTGACACTTTGGATAAGAGAGGTCAGAACTGATGCCACAGTAATGAACAAGCCGACTGGGGGAAAGGGCTTG
CATCTAGTAAAAAAAAATCTATCACCAAGCCAACTTCGTTTCATTTTGTGAGCTTTACTGCCTTCACAGATCGGCTAAGATCTAAAACTGCGTTTCGTGT
TGTGTTAAAAGCTGACATAATTTTGCTTAAACAAATACTGAGGAACCCGGTGCCTTTTTATAGGGCCGCTCTGAATGAACTTAGGGTTAAGACGTACTAT
GGAATACTACCGTAAAGTCTATGAAAGATACGGAGTCATTCAAAACTATAGAATCACTCTCTCGGACCCCTTAAGTGGTTTAACCATCATACTACGAACC
ATCCTTCAAGAACTGTTCCCGACGATCTTCCTGCCTCTATGAACCCCAAGAACCGCCAAATGGTTTTACAAGACACCCATTCCTATTCTAACTCGCCTTA
CCACATTAAATAGTTCGGAATTTGAAAATGTTTCATTTTAAGACGAGACCGAACAAATATATCTCTTGTGCCTACAGCTGAGGCGCGTACTTGAACAGTT
CGAAAAGCTATAGACTCTGATCAATGGTCACCCTCTGGCCAGGATGCAGATAGCCTTCCATTCTCCGTCCTTGAAGGTCTCACAGTACTGAGCACTCCAT
GGTACTACACCATTCTCAAAACCAGGTTTCTCGTCAGGTTCTTGTACTAAGCAATGAATTGCCATCATCTCCACCAGAGAGTTCACCTAAGCAGCATATT
GCCTTAACTACAGTTTTAGCAGGATCTACTACTCTTTCTGCTCAGTCAAAACCCCCTGCTGATGTTCGACAAGCCCTACAAGAGACGGATTCTGCTATTT
GGCGTGCTACATGTGAAAAAAGATCTTTCAGCATTTATTAGCCGTAATGTCTTTGGCCTCGTTCCACTCCCTTCTGAAACTCGAGCCTTGGGTACTCGAT
GGATTTTCGCTATCAGGTGAAACTCCGTAGCCGAAGCCCGTCTGGCGGCGCAAGATCATCGTCAAATTGCCAGCATTGGCGACAACACCCGCGCTCTAAA
GGTTAAGAAAAAAGTCACTTGTTTAATACTTATGTAATATAAAGATAAGTAAGTCGTTGCAATCGTAAATCACTCAGAGATGTAAATTCTACCCTCCCAT
GGCTTCAAAGTCCTGGAAGAGGCATCTACCTCCTTCTTTGGGAAGTTTCCAAACTCCAACTTAAACGAGGAGCTATCATTTGGAATCGTAAAGTCCACGT
TTTCGGAGCTAAAGTTCAGGGCCGCAAGCAAAGTCTTATTCTCGTACTTCTTGGTGAAACTGAACAGTTTCTTGTTGTCCAAGTCGATGAACTCGAAATC
ATAGCCATAAACGGTGATATCCTTGTGTGCCTTTCTAAATCTCAAAGCTTCCTTCCAGAAAGCTAACACAGAGTTTGGATCCTTTTGCTCGTCTTCGACG
TTGATTCCCTCCCTGAAAGATTCGTTCAAGTAGAACCATGGCTTGCCAGTAGGCCCGGAGAAGCCAGCATTTGGCTCTTCATGAGTCCAAGGCATAGGGG

1,268,804bp truncated ...