Sign In

S. eubayanus strain FM1318 ( SEUB3.0 ) - NC_030984.1
Saccharomyces eubayanus strain FM1318 chromosome IX, whole genome shotgun sequence

>NC_030984.1 Saccharomyces eubayanus strain FM1318 chromosome IX, whole genome shotgun sequence
TGTTTGCAAGTGCACAAATGTATGTTGTCAAGATGGAAATCGGGACCCCTCCCCAAACGGCTTATCTCCAGTTAGACACTGGCTCTTCGGATATGTGTGT
TAATGAGGCCGATAGCGCTCACTGTAAATCATTGGCCGACGATAATAACATTTGGACTAGTAATTACGAGCTCACAGCAACTGCTTCTGAGATCTCTTCT
ACAGCTACTTCACGTAAGGCTTATAATACACCCTGCTCGTACTGGGGTACCTTCAATCCCAATACCTCTTCCACGTTTAAGTATAACGAGACAAATTTTC
GTGCAACATACGCAGATAATTCGTACTATGCAGGAACTTACGGGACGGATGTTGTCTCTTTGGGTAATATTACTCTAAGTAATTTCACTTTTGGGGTGTC
CAATGATACGACAATAAGTTATGGAATTTTAGGCGTATCGCTTCCTTCTGCAGAAGAAACAGATAATATTGAAAGCGCATTTTCTTTCAATACAACACCA
TTTGTATACGATAACTTTCCAATGGCATTGAAAAGGCAAGGAAAGATCAAAAAGATGGCATATTCTTTGTTTTTGAATGACCCTAATGCACGCTTTGGAA
GCATCTTGTTTGGCGCTGTTGACAAAAGTAAATACTCAGGACAGCTTTACACTCTTCCTATGCTGCAGGCTTACAACACCCTTGCCGCCCGTGGTTCAGG
GATGGTAATCACAGCACAGAGCGTCGCCATTTTGGATAGCAAATCCGGCAACAAAACTGTTTCAGATGTTCAGTTCCCAGTATTGCTTGATTCTGGTTCA
AGTGATCCTACCCTACCCACTGAAATTGCAGATGCCATAGGCAAAATTTTCGATGGGAAGTATAGCTCCGATAACCAAGGCTACATTTTTGATTGTTCAA
AAGTGAACGACACTCTATTGTCTGTTGATTTTGGAGGATTCAATATTTCTGCAAACATATCCAATTTTGTGACACCACTCAATGATCACTGTCTTTTGAA
TATTGATGCCGATGAGTCAGGGTTTGTGTTTGGGGATACTTTCCTCATGGACACATATGTTGTCTATGATTTAGAAAATCACGAAGTTTCTCTTGCTCAG
GCCAGCTTTAATAATGAAGAAGAAGATATTGAGATTATCTCTGATAGTGTCCCAGGTGCCACACCTGCTCCCGGATACTCCAGTACGTGGGTGTATACGC
CCGGTAGCCCCATCGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGAAGTTTTCATTATTATGACTCCAAAACAATGCTTTAATT
TTATGTAGGGCAGAAACTCTTTGCCTTTTCTATATATAGTTCGTAAATCCGTCTGTTCGATTCTGAGTCAGGAAACCTGACTTTGTATTAGTTCCACAAT
GCCCTTAATGTCTTTGTTCAGTGTTCTGCGTGTCAGAACACCCAAAACCCACACTCGCCCTTAAACGTGTGGTTCTTTCGTGAAACTCTTGGCACTCTTT
CGCAAAGACATATGCTTAGTAATACAATTCAACATTTAGCGAAGTGCAGCATTGAACATGGTTTTGCGTACGCCAGATACGTGGAAAAGACACCGAATCA
TTTCATGTTGTGGTGGCAAAACTCTCTCAGGAACGATAAGCTTGTAAAAATACCCTTAATATCTCAGATAGCATTAGTCGGCACTCAACTGAGATATTTA
TCAGTTTCATTTACTATATAAAGACAACAAGAACTCGCAGGCTTATCAGGATTTCCTAAACAATTGAAGTGATATAGTACACATACATACAAGTTTAAGC
AATGGCAGAAGAGGTCAAAATAATATACGGAAGCTTTCCTCTTAATCTTTTGCAACGGTCAGATATCGATGAGATATCAACTATTTTGGAGAAAGCAGGA
GTAAAAGATATAGATACTGCACGGATCTACCCAGATAGCGAAAAAATCCTTGGCGAATTCCGGGTTCCAAGTAGATTTACTATTCATACAAAGGCTAGCG
GATTTTCAGCTGGATGTTTAACAAAAGATAACATTAATAAGTGTATTGAAGAGTCGTTGAGCCTGCTAGGCGTTCCAAATGTTGAAACATATTTTTTGCA
CTCGCCAGACCCTGAAACTCCTATTGAAGAAACTCTCGGTGCAATAAACTCTCTGTATGAACAAGGTAAATTCAAAAAGTTTGGGTTATCAAACTTCGCA
ACGGAGGACGTGAAGCGCATCCACGAATATGCAAAAAGCAAGAATTACGTCTTACCAACAGTGTATCAAGGAAACTATAACGCGTTCTCACGGGCGATTG
AGGATGATCTTTTCCCCTTGTTAAGAGAGTTGCATATTTCTTTCTATGCGTATTCACCAATCGCAGGAGGGTTCTTGGCGAAAACTGTTGAACAGGTACT
GGAGAGCAAATCAGGCCGGTTCGACAAGAGCAATCATATTGGGCAGTTGTATTTGAAACTTTATAACAGGCCTGCTCTTATGAAAGGGCTGGAAGAATGG
AACAAACTCGCCGAGAAGACAGGTATATCTAGGTTCAGTTTAGCTTACAGATGGATTGCTCACAACTCTTCTCTAAAGAGGGAATTTGGTGACGCTGTTA
TCATTGGAGGACGGTCTCCTAGTCAGGTTTCTGGTGCGTTGGAGTCCATTTCCGAGGGGCCTTTAGACCCTGAAACGGTAAAGAAAATCGATGAAATTTG
GCAGCTAGTTAAAGATGAAGCACCATTAAATAATTACGCTTACTAGGTACCTTTTTGACTGCGCATAAGAGAATACATATCAACGGGTCTTATGTACGTC
AAGTTATGTTTCTGTGTACTTGACAATAGATAGCAGTCGTTTCAGCCTAAATAATATGTTTTTACTCAATGAGTTGTCTCGCCTCAAGCAGAGTTTAATA
GATCGTTTGGCCATTGAAGGATGAACAGATAGAGCAGGTCTCACCAGTGCCGTGTGTTTGTTAATTTTGTCTTCTCCAAATAGTGAATAGCTTCTATTTT
GCTCTATTTTCAACTTCAAAAGGTTGATGAAGAAGGCGTAAAGATGTGAGTCCATGTTTTAGACTGGAATTTTCTTGGTTCTATCTCGATAATGCACGCA
GTAGTTTAGGCTATTTCAAATGCCATAAAATTTTACCAAGTATTGATCACCAAACTCCAAATACCTGGCTAATCCAGCCAGGGTTTTTGCTACATTCAGC
CACCCCTGTGTTAAGTGAATAAAGTTAGCTGAGAATCAATATCCGATCATCATGTATTTACCAAAATCCGTATGATAACGCCTCTCCCCAATAACTTGAC
GCCAGTTCTACATGTTTTGCTTCATTTAAAGCAATCCATTACTTACCGAACTTGAAAATAGAACTGCCTGAATATCATGATGTTAAAATAAAAAGATAAT
TCCACAGAACTTGAAGTACAATTCACAAATACTACAAGCCAATAGTGATGCCATCGCGTTGTCGACTACTCCAGTGATGACACAACATAAAGTGCTTATA
TTTTATATGTCTTGAATCATTTTAACATGCAATAGTAATCAACAGACACGAGAAGCACCGCTATATGTCTTGAATCATAGCATTACAAATTCGTACTCCA
TGTAGTGTCCGCCAGGTCCTCCAGACTCTACAACTACAGCATACCATATCAGCACACACCTACACGTCTTTCACGATACTGTCTCTAGGTATGTACAGTG
ATATAATAAAATATCAAGAATCTCAATGCTAATGCAAAATTTTGCCCAACAGTAGCAACATAACATTTCCCAAATACAATAGTCCGTTTAAAATCAATTA
CCAGAAATTCAAGGAGCGTTCCTCGTGTAGACTTAATCTGTTAATCGTAACTATAACTGATTAGTCGTGTATACTGAACCACATTTTCATTTCGCGGCTA
AATGACATTGCTTGCTTTATTTGCTGTCACTTGCTTCCATCCGCTAAAAAAAATCAAAAAAATGACCCCTCCGATAAAGTAGTCATGGTCTACGCCCTAT
GCGCCACCGCCTCTAAGGAAGCGTTTGAATTATTTGGTTGCATGCCATCTTACTATGATAGTAGTGCATATAGTAGTATACAAGAATGTATTTTAAGAAG
TGACTTTTATATCAGTGAAATATATAATTGAATAAAAAAATAAATTAGTGGATAAATCTATAATCAAGGCGCTTCATTCCTAGATCACTAGTAGTGTCCA
AGTAATTGGTCTGTTCTTCTTTTGTCATTAAATTCCATTTGCGTTCTTTATATCTATTTCTACTAATATAGTAGAACTTTGTGGCAACTGCCATGCAAAT
GTTGAAACAAGTAAATCCTAGAAGAGCCTTGTTACCCTTGACATAGTAGGGCTTATCGTCATTTCTGTACAAGTTGGAAGCAATAATTGTTCCAATCTGA
GCACTCATATTGTATAATGCTGTCCCTATCGCACGCGATCTCACCGAATTTGAAATTTCGGAAACCCAACCTGCAAGAATGGAGTGAGTGTAGGGAAGGC
CAAGTATTCCGGTGAGTAATACGTACTTTATCCATGGATTTGTATCTGTTGGCAAAGCGACTAAAGAAACAATAAAAGGAAGCACCCAAACGTTCGCAAT
TCCTACACAAAGTGATTTCTCTTTCAATTTGCGTGATAGCAATGCCACTAATGGTAGATTAATTAATAGCAAAGCTTGACCTGGAATTGCCAAAATATTT
GAAAGAAAGGTGGAGAAATTCATGCTTTTTAAGATCAACGACATGTAAGGTGTAACGGTTTGTAAAGATATAAATCCTGTGATTCCTTGTATGAATAGTG
GCCAGAGATCAAATTCCGTTAAGGTATACAAAATTTCCTTAAAAGTAACGGGTTGCCTATTGCTCATATCACCCTTTGATGGATCATCCCGTAAAATTCT
ATTAACCATAACTTTTTCTTCATACTCAGTGAAAAGCGATTTCCCATTATGGAACGCAGACTCACCAGTTTGAGTGGGGCCCCTGCGCATCAAATAAAAG
GATGCCACACCAATGGCTAGGGATATAAATCCTTCAATGATGAACAAATACTGCCATCCAGCCAAGTTATGAACTCCTCGCATCTCTAAAACACCGGAAG
CAAAGAGTGAGCCTAGAATTTGGAAAAGGGGGATAGCACACCAGAAGAAACTTAAGCGAAAAGTAAGCTCGGCTCCGGTGTAATAATAAGACAGGTATAA
TATGTTATCTGGAATAAATCCACCTTGCACAATTCCTAATAAACATCTAGTGGCAATAAACTGAGCTTTATTTTTCAAACCTGCTTGCGTAATACAGATG
ATACTCCAGAGGACAATTTGAATTGGTATGACTCTTTCTGGACCAAATCTTTTAGACAGCAGATTACCAGGTAGCTCACTCACCAGAAATAAAACTAGAT
AAACAGTCTGCCCAAGGTTGTAGTCATTAGTATTCATCTTTAAATCGGTAATGAAGTTATCTGAGACAGCCCTGGCAATGTTTTTTCTTATCAAATCGAG
AAAACAAAACATGATAAAGACCCACAAGAAAATCTTCAAGTCTATTTTTCTCACTACCCTTCTCTCTTCATCCTTACTCCAAGAAAACTCGGGATCAAAT
TTAGACAACCCCTCATAGCCACTGGACTCGTAAACTTTTCTCCAGCGCTCAGCTTCATCAAAATCTTCAAATGGGTTTTGCGACTGGCTTTCTGGATCCG
AAGTTAAACTTTGTGTGGACACAGACAATTGAGTCTTTTCTAAAACAACGTATTCCTCCTTATGTTCGGACATTGCTAAATTATATTCTGCTTCAGTTCT
TTGGGTGTATAATTAATGGCTCCATTGTGGAATTCTAAGACATTCATCGCGATGGCTGTCTTCTTATAGTAAATTTCTATAGCACGGGATGAATCATGAA
TGATGCAAATATTGAATACCATTGATAACTGTCCCATACGACGGTACAATGAACGTCCGAATGTTATTATTCGGTCGTCCACTACCGCGTAGGGCTCCTT
GTCTTTTCTTTTACTCCCGCTATACCAAAAGTATATTATTCTGAGCCAAAACCTCAAGTGAGGCGTCAGTTCGTAAGTGAAGCCTCAACAAGGGCTTCTG
ACATCTTAATCACGTGCCCATCAGACCCTTTGTGCATAGTTTCCTGCAGGAGTCCATGCGTTGCAAAGGGGTGAAGCAACATATATGTGTATCGTTTGCT
CGAGGCTGCAGTCTCGAGAGTGGCTGCGATTCGATTGTGCTATGACGCGGCTCGGAACATCATCTATCCGAACTTTTTTGACGTCGGGCCGAATGATTTT
TCAGCAATTGGCAGCACATAAGGGCACAGCTGCTTAGCTTATCGCATGAATCTATCTAGTTTTAGCAACTTGTTTGAGTAATATACTAACAATTACAGGT
GAGCTAGTATTTTCGATTGAAACATCCTGAAGAAGTCGGACCTGGAAACGTTCTACACAGGTGTCAATAGGGGTGCATTTTTGTAGAATTTATCGTAGAT
TCATCTGCAAGTACTTTACGGTTGTAACCTCTGCACCAGAAAGACAACCATCCGTCAGAAATGCAGGAGATAATTCGAGCTCAGATTTTGGTAAAAAAGG
TTGGCTTTTTTTTGGTCTCTCCCGTTAGCGGGCCTTTTTATAAATCAAGTGTTGTAGTATGAATCTTGAAACTGGATATCCTTTCTTGTAATCAGAATAC
ATAGAGAGAGATGGGATTCAGAGCTAAGTGAAAGAGAAAGAAAACATTTATTAATTTTTCTTTTTTTCATTGAAATGCAATTTTGCGGTGTATATGGTAT
AATTTCTTCTTACTAAGATGTACGATAAGATTTTGATATCGGTTGGGCCTCTTTTGCAGAGTACCGTTGGAGCTGCAGCGAATATTGCGGAAAAGATATG
TTTAGAAGATTAAACCAATTTTGTATTGGATGAATTTGCTGCAGGCTGAATAGACCGCTCTTCCAACAAATATCGTCTGATACAAAAGAGGGAGTTTTTT
TTTTAATTATGCACCAAAGTAAGAGCGCCGAGCCTGTGTATCGTCACATTAGTGATGTCCGTTCCAGTGCTGATCAAGATGCTCTTCGAAAAGGCATTCA
TAGTTTTTGATGTATTTCTGCTGACTCTTTCCAAAATTAGTCACATCCTTACCTAATTGACTGCAAATATGTAAAAATTCTATACAATATACCACAGGTT
AACCAATACCCACTGGAGCGGTTAAAATCCGGTGTGCACACTTATTTGGTAAACTTAACGTCCTGGGATCTTTCATCAACGCTTAACTGGAAGACGTCTC
CTCTGGCGTAGTGACCCACTGGGTCTAGATCGAAACGGGCTTCGGCGATCAAGTCTGTGTTAATTTCAGCGGCTAAAAGGCCCTCTTTGCCTAGCAATGG
GCCTGCAATAATTTCTCCGTAGGGATCAATGATAACGCTACCTCCATTGATGCAGTTCTCATCAGTTGATGACCACCCAGGCAGTTTCCTCTTACCAGTA
GCTTCGTCGACTATTTCTCCGTATCCCATGGTGGTCGCGTCAGGCATGAACTGTACTGCACTTACCAGAAACAAGCGACCTTCATAAGCGATGTTTTGCA
TCACAGTTCTCCAAATGGGTCTAGCATCCACAGTGGGCGCACACCAAATTTCAACACCTTTTGCATACATAGCGTACCTCAATAACGGCATCATATTTTC
CCAGCATATAGCACCACCTATCTTTCCGACAGCAGTGTCCACAACTGGTAAAGTTGAACCGTCACCTTGGCCCCAGATTAATCTTTCACCAGCTGTTGGA
ACCAACTTACGATGTTTCGCAACGTAACCAGCCCTAGGATCAATGAATACCATAGTACAGTACAACGTTGTCCCATCACGCTCAATACATCCAACACATA
GCGAAGCGTTAGTGGCCTTTGATAATGCACATAATTGGCTTATTTCTGGATATTGATCACCAGACCCTATTTCGATTGCCTCCGCAAGATACCTAGCAAA
CTCTTCTCTTCCTTCTTGCAAACGGTAGCCTAGATATACTCCAAAATTTGATCCTTTGGGATAACCACCAAGGGTAGCTTCTGGAATGACAACCAGCTCG

395,362bp truncated ...