Sign In

S. eubayanus strain FM1318 ( SEUB3.0 ) - NC_030980.1
Saccharomyces eubayanus strain FM1318 chromosome V, whole genome shotgun sequence

>NC_030980.1 Saccharomyces eubayanus strain FM1318 chromosome V, whole genome shotgun sequence
CACACATTCCTATGGACGCTAAAAAATTACGTTTCGTATTTTATATTTTACTCTATTTTTTCAGTTTTCATCATCTATATACTTATATGTGCATAACTGC
ACCTAGACCGTAACTTTCCATGCTCTTATTTTCCATTGGCATGAAAACAGACCCACAGGACATTGAACCACCGCATACTCCCATCATTCAGCTCACTCAT
CTTATGGCTTTCCTCTTATTATTCCCGCTCACTTAGCCGCCCAGCTAACGCTCGTCCTCGGGGAGCGCGTTCCGACATAATAATGTGACAGTCATGTGAC
GATGTTCAGCCAGCGCACGCGCGGCCGGGTAGCTAGGGCCGCTTCTTTTGAAAAACAATAGGCCAGGCCGGGCAACCAGGGCTGTTTTTCTACAAGGCAC
TTACCCAGGGCCAGATTTGAAAAAAATTCAACTTAAATCCCGAAAGCGTGCCTTCAAAAAAATGAGTTTCCTGCGCGTTTTCTTAGAAATTGGGGCCGCT
TTCTTAAAAAAACAGGGCCGCTTCTTTTTGTCCATAGGCCGCTTCTTTTGCTTTATGAGCCAAGTCCGCCTTTCGGCGGACTGTCTCATAAAGATGTACA
CTATATCCTCGTCACTGCCTCCTATTATGATACGATAACCACCACTTATCTCTATATATACCATATATCATACCATATACCACGTACAATATACCACCAC
CACATACGATCGCTTTTCCCAAGACCGTAACCACCACTTTCTATACCATATACCTATTACTATCACTCTATACATACCATAATTCATTACCGTAACCACT
CTCAATAGAATAATGCCATACTCTACCACTCTCAATAGGATAATGCCATACGCTACCACTCTCAATAGAATAATATATCCACATACTCATACGGACGCTA
AATATACTTTCATAACACACTATGCTAGATATCCTAATATCTATTATCATCACCCTAACTAATCTCAAATTACATATACATATATCACTTACCATCGCTC
ATCCAATATATCATATTACCATCACTCTCAATAGAATATGAACACCTTCAACCTCTATAACCATAACATCCTGCCCCAATACCACCACTCTCAATAGAAT
ATGAACACCTTCAACCTCTATAACCATAACATCCTGCCCTAATACCACCACTCTCTCAATAGAATATGAACACCTTCAACCTCTATAACCATAATATCCT
GCCCTAATACCACCACTCTCTCAATATAAGAACATACTAGATCACCCCTAATATGATCGATATCTCTACATCAATAATAATAATAATATTATAATACCAT
ACCACAACCACCACTCTCTCCATAATATCTTATAACGGATGCACATACTCACACGGACGTTAAATATAATAACCTCCACACATCAACATCACCACACTAA
CTCACATAACTACCTTCATTCCTGCCTTTTATCATCACACAACTTCTATCTTAACACAATATCGCATAATATCAAGAATTATCAACTATAAAATACTAAA
CACCACACATCGTTCTCCACCACTTCCATAACATCTTATAGCATAATAGCACCATCACCCTCCGCTATGCTATCACAATGCCTTCCATACCAATCGCTCT
TGATACCTCAATATCCACACCCCCTACCGAACTGCGCTTCCATAACTGCTTCATCTCCACATCCATCACCAAATTCAAGGAAAACTCATTATTCTACGCA
CCTCTACCTACTCTCACATTCACATTCATGATCTCAAATATAACAATACATAACCTCCCCTCCGCCTGACTGCACTCATTACCTTTATCCCCACTCTCAA
CAAACTACGTAAACCCATTACAACACACACTCTAAAGCACAACATTCCGCCTTACTTCCGTCTTACCACTCTCTATACATACAATACAATATATTAGATC
GCACACTCACACGGATGCATTGATATATCATCAATACAGCTCTCTCGAAATATCCCGTAAAATATTGAATCGGCATACTCAGACGGACGCTACAATATCT
ACATTACCGTGATACCAACCCTACGCTCGCCATAACCATGCTCATATGCCCCCGATGGCATGAATAGAGACCCAATGGATGCTGACCTGCAGCATACATG
CTCGTCTTAGCGTCTCTTATTAATATCGCTTACTTAGCCGCCCAGCTCACGTGCCTTGCATGCGGCTGAACACTTTTTTTCGGGCAGCGGGTTCCGACTA
GATCATGTGACAGTAATGTGACCATATTCAGGAAAGCGCATGTGCGGCTGGGTACTCAAGGCCGCTTCTTTTAAAAAACAATAGGCAAGGCCGGGTAGCC
ATGACCACCTTTTGAAGGCACGCTTGCGGGATTTAAGTTGACTTTTTTCAAAAGTGGCCCTTGGCGGATTGTCTCATAAAGGTGGGTTGATATACTTTTT
TGAAAACTTCCTGTAACAACAACTGTTGAGGTTAAGTATTTTTCTCAATTACCACTTGCGGTGTCTATTTTTGTACCCGCATATCTCACGTTTAAGCACG
CACGTACCTCACTGCTTGACAAGGGGGAAAATATTAGTTGAAAATTAATTATAAATTAATTATAAACGTTCACTATATAAAGAAACTTTCTCTCAATGTC
CTCAAGCATACAACAATATCCCACAAAGATGTAGACACTTTTCGGAAAGTAACGTTTCATGACTGATCTAGCAAAAATAGGCGCCAATCGTCTTCAAAAT
TCATGGAGAATTTGGAGACGCAATATACTATTATTTATCTTCGTATTTACTGTTTCTTTTTATTATTTTCGTTTCAGAGATGCAAAAGCTTTAGTCGATA
CCGCAGTGATTGCTTCACCTATGGTGGGCAATCATCTAAAGAAAAGGTAAAACTACTATTGGGCGTTGGCTGGAGGTGCCAGTGGGTTCTTAATCACGCT
AGCAGGAATATCCGGGGCGTATGCTGCCAATAAATGTACAAGTAATCTAGGTAGCACCTCATGTTGGGTTGGAGCTGCAGTTGCATTGATCGCAGGTTGT
TTAGGCGGTGTTGCTACCACAGCAGCAGCCATGGCCGGGGCAGCGGGTTCAGTAGTATCAGCTTCAAAAAGATCCACCGGATATATTGATACTTTTTCTG
ACTTAAATTTTCATTACTGAAACATGATACTATAGTTTAAAAAGAACACTGCTGACCTAGAGGCTTGAAAAAATATCTTTAAAGGGAAATAAAACGAGAC
GAAATAAAATGTAGAGAACACAAAATGATAAGGAATCTCACACAAAAAAATATTGGGTTAATAAAGGTAAGGACCAATGATACATATTAGACTTCGATTC
TCTCACTTCAAATAACTCTCTAGACGCCAAAGCACGGGCCTGGATTTGATTAATCGCTGGTGCACAAACAATAATGGATATGAAAGTTGCAAACAAGGCA
TTTTGGAGCCCTCTGTAACTGTTTCCAACATCGTAAAATGAAAATCCAACATAGAGGCCGCTTACAAGCAGTAACATCATTTTTGACATAATATAGTCCA
AATCCCTCCAGAAGGTAACAGCAGTACGCAAATAAACATACTTAAATTGGTAGAAGTAACCAGTAGCATATTTTTCAATTTTAGAATCACCTTTCAAGTC
ATCACTGCTCACTGAATTCTGAATCAATCCTTGAATGGTACTGTCGACAGCCTCATTTTCTGATGACCTCTTCCAGATTTCATGCCAATCCTCAGACACA
CTAGCAGTCGCACCTGCACCTATACACTCCAAAATGTATTCGGCTGGATTTTCGGACCTATTACACTTTCTACTGCCATTTCTTTGAAAATAGTCTAGTA
CCATAGAGGAGTTATCGCCAATATCACCAAAATAAACAGTTTGGCCCCCTTTTTTTAGAAGTAGTAGCCTATCAAACTGTTCAAACAACGTAGCAGAAGG
CTGGTGGATAGTACACAATATTGATTGGCCTGCATCAGCTAACTTTTTCAATAATTGAACAATAGCCCAAGATGACTGCGAGTCCAAACCCGAAGTTGGC
TCGTCCAAAAATAGTAACAGGTCTGGTTTGGCAACCAGTTCGACACCAATAGATAATTTTTTTCTTTGCTCAACACTTAAACCAGCTCCAAGCTCCCCTA
CGAGGGCGTCCGCATATTCATTCATGTCTAAAATGTCAATAATCTTCTCTGCAAATGCTACTTTTTCTTTGTCGGAAATATATTGGGGACGGCGCATGCG
CGCTGAAAATATTAGAGATTCTCTCACAGACATTTCCGCAACATGTAAATCCTGCTGTTGCACATATCCAGTTCGTCTCTCAAAACTTTTGTCAAATGGA
CACCCATCGACCAGCATGTCTCCAGTAATGATGCCGACATTTCTTTGAGCTAAAGTGTTCAATAATGTTGTTTTACCAGCACCAGATTCACCCATCAGAG
CTGTGAGAGTACCAGGTTTACAATAACCTGACACATTGTCTAAAAGCTGCCGTTCCCCTCCTTTGTATTTGATAGTATAGCAAACATTTCTCCATATGAA
CATGCTTGTACTACTCAGGTCTTCAAAAGTATCTGAATCATCCACGGATGGCTCAGTTTTTCCTCCGTTGAGAAAACTTTCAATATCAGGCTCATTCATT
TCATCCGCAATCTCTTCATCAGGTGTGACTTTTCTGGCAAAGTTTTTTGCACCTTTCTTGTAAATAAGAGCATCCCCGCCTCCTTTCATCGGCCGTTTAT
ACTCTGTTACAACTGCCATTAAAACAATAAACCCGATAATAAAACACCATAAGATACCAAAGTTTCTCCCGGTATGCTTATAGTCGTAATCGAATTGTGC
TTTCAAGTAATCGTCACCCAAAACATAGGATTGACTCGGACGAGATCCAACGGATGCACATACGCGCTCATTTGGTTGAACATTTTCATAGCCTGGTCCA
AATGGGATGATACCGCTGCCACCGCAGTTCATGCGTCTTCCATGGAACTCTGCATTAAGCATGGATTCAAATGCGTATCTTATTGGCAGGATATACGCAA
TCCACACAAACCAAGGGTGCATCGAGGGTAATTGAATCATGTATGTGGAGTACATTGAAATTGACAGAGTTAGGACACCAGCAATTGAATTCGCTTGCGA
AATATTATCGCATGCGGCTGCCACTAATTCAAACAACCCATTTATCGCCTCTGAACACATCCCTAAGAACAAAAAAACCGTAAAAAAACTCCCAGCAGAT
CTATGTAGACCAAGGAAGTACAAAATGATGAAAAACAGAGTTAGTCCAATCATCCGGAATGGAAATGCAGCAATGGTATTTCCTAAGGATTCTGCAGACG
GATGGTATAAAGAGTAATTTTTGTGCTTTTGCAATATTGGCCTGTAGTCAAAAGTCATATTAGCCAGACCCATCAAGGAATAATATAACAAAGAAAAATA
CAAAACACCACCTCGAGTAAAAGCACCATCATTAGAGGATGGCGTATTATAACCTAAAGAACCGATGATAAAGGCAATAGCGACTGCAGCAATAATATTG
ATAATCGTAGACGATTTATTACCGTAAATTCTCTGGAAACCTCTCTGGGTACATAGTTGAAGCTGTTTCCAGTACGAGATTGTGTAGTAGGAATTTTTCC
TTGTATATTTTGATTGTTCTTGATTAATGGATGTCTTTAACGTAGTCTTAGATATGTCAGGGCTTGATCTATCATTGTAAGTTTTAATATCATCCTTTAA
TTTGGCTAACTCAGGAGACTCTTTCCAGAGTGTTTCAAATTCTTCGGCTGTTCTTGGAACCTTATTTTCAAAACCAGGTTTGATTTTGTGAAATCCATTA
GGATCTGTTAGAGCTGTTAGAAATTCAGGAGTTGATTGTCTCGGTGGATGCTCGTATCCAATTCTCTCAAAGTAAAGTTCTGCTTCTTCAACAGGACCAT
AATAAATCTGTCGGCCCGCATAAAGCAGAGTCACATTGTCGAAGGTTTGGTAAATATTTTCACTGGCTTGATAAATTGTTACAAGAGCGGTGGATTGGAG
TAGATTCGTCATTATGCGAATAGCCTGCGCAAATTCCAAAGCTGTGGAAGCGTCCAAGCCTCTTGTAGCGTTGTCCCAGCAATAAACAGAACCCCTGGCT
ACCACAGCTTCTGCAATTGAACCCTTTTCCTTTCACCGCCAGAAACGCCCCTGACAAAGTCATTTCCAACTTTGGTATCGTATGTATGTGTTAGACCGAA
GACAGTGGCATAAAAGTCTCTCGTTGTAGAAATATATTCTTCTCTAGACATGTTATTAACCCTTTTTTGAGGTGTTTTGCAAGCAATAGCGAAATCCAAA
GTTTGTTTAACGGTCAAGTAAGGAAATGTACATCTAATTCACCATTGTAAATCACATCAGATTTGAAATTTTTAATCATCTCCGGCTGCGAAATGCCGTC
ATATGATACTGTACCACTAACTCCGGAAAATTGATCGATGATACCACCAGCGGTCTTTAGCAGAGAAGAACAACCAGCACCAGGCCTTCCAAGTACCAAA
ACCATATCACCTGGTCTTGCTATTAAATTGATGTTTTGAAGGATATTTCTCATCTTCTTATGCCTTTGAGATTTAATACCGTTATATATGGTGACCGGCA
AGCGCAAAATATCACCAAATGTTGCCGATTCTACCAAGCTGGTATCGACACCTTGGGTTCCCACATCTTCAAGAACAACACCTGTTTTCCGCAAATGAAT
ACCTTGATCGCTAGCATCGCTTACAAATTGTGACAAAATTTCTTGAGCATCAAACCCAAGGTTGAGCGATTTCCCATCAAAAGGACCCTCTTTACTAGTA
TGAGAAGATAGTACGCGTGCCAGGCGATTAATATCAGAAGTAGTCTCCGCATCAAGAGATGTAAGGGGAACTTCACTGTCGTGTTGGCCAGGCCGAAACA
ACTTACCTTCCTCCACAGAGCCATTGAAATTTTCAGTACTCCCAGCTTGAGATTGTTGATCGACTCGGTCGCTGCTGTGTCCCACCATGTCTTCAGACAT
ATTTGCGTATGTTTCTGGTAACAAATGCAATCAGAAATTGGGCCCTTCTTGCTCTGAAGTACTGTTCTCTACTTCCAGTTGTATTCCCATTTCCTTCATG
AACTATTGCGATGATGGCACGGCTTATATATGAACGATAGCAGCGATTACAGAGGGGCCATGTGCGCGCATATGACTTCTTAGTCATAGAGGATACCCTC
TCCGAACAATTCTTTAAATGTCATGTGACCAGATAATATGTTGATTTACCTTTGATTCCCTCTGTAATGAACCGAGTCTGTCGGCCATATATGCCACGTA
CTCAAATGGTTATTATCAAAAATATTCCTAAGACCTTAAATTTTGTTTAGTGCAGCAACATACTGGTAAAAAGAAAAGGTTCTTCGCGGGATAAGCGCCA
CGATGTCACTATATATATATACATATGTGTATACTTTAGACTAATGGGAACAAATTCATTGTGCGGCAACAAAAAGGAACGGTTATTGATTTTGGTTGAT
GATCATATGTCAACCCAAAAAGCAGATAAAAACCTCAATTTGTTGGGCAATATTCAATCAAAAGTAAGGGCATGTATCATAACATGTCTTGTTCTTCTAT
TTCAAACCATTCTGAAAGAAAAGGTTCTAAATCTTTGTTCATCCAGGCAGCGATGGAGCTATCGTAGTGATCCCAGAAAAGGTCCGTTGTTCCATTCTCC
TAAAAACTATTTGTAAAAATGTTTAATCTCACGTGTATTTATATTTTCATCCATATCTAAACTCGGCACAGCATTTGTTGTGTTTTGAGATTCTTGATTT
ACTCTGAGTCCATTCTCAAATATCATACGGCAAATATTCTCCAGCGAAAAGATAAAAAGAAAAGAATAATGCTTTTTCATTATTTTTAAGAGCTGTTTGC
AATCTGGCGCATAAAATGTATCAAATGCCGAATTTAAGCTCTTACTGACATTTTTGAGGCTTATGTAATGATCAGTGGGTATTTGAAATGACTCAAACGG
AGGTTGGGAAAAGTCAAACTCTTCTGTGAAAGCAGATCGAGGTATTGGAGACAAGAGGCTCGAAAATAGTGTACCATACATTTCGTAAAGAACTCTCCCT
ATCGTATGATATGTAACCCACATGCCTAACTGAATATGTGGAGGCAACCCACCAAACTTCATGGAGATTCATAATGGGGATCTTCAATATCCATTTTGAA
ATAGGAATTCAATACCGCGATTGATATATAGAGGGAAGTAAAGGACAAATGTATTGACATGTTGAATATTTCAAAGCCTTTATCATTGAAGTAGTATCTC
TGTATATTAGATAAATTTGAAATGCTGGTAAGAAGAAGTAAGAGAGTGTGTACTTCAATCCTCTCATTGAAATCACAGCTATCAGGTGACATATAATATG
AAAGCGATTTGTAATTGAGAGTGACAAATTCTTTAGCATCCAATATAAGCTGTTTAACGCTTGGAACGTTGTTTTTGTCATATATTTTTTCAAGTATACT
TCTAAGCATCAGTATAGATTTCCTAAAAATTATGTCTTCCCCTGGTGTATAATTGAAGCGAACTGTGGGTAGATCATTAATCTGCAGTGCGGTTCCAAGA
TTAAAGGATACTTGAACGTCCATGTATAAAATCCACCACCAAAGATTTTCAATGTATACCTGATCATGAAAATTTATGGGAATCTCAATATCACGGTTTA
AACCTAGAGTGCATGCTAACGAACAAGCGGTCTGGATAAGCATATACACTCTGGAGAAATCGCAACCTGAAAAAGATGTGAAATCGAAATAGCACACTTT
CAACATTATGCATTGAAGTCTTTCTATGTTGAAAGACTTTACGGGAACAGAAGATGTTAAGAATCTGGAAAACATCTCCAACTCTTTGGGTATGACCCTA
TAGTATGTGCCACGTAAAATTTCAAGAATCACCCCTACACAGTGGATGTTTTGAGGGCTCTCATACACAAGGTCCAAGATAGGATGGTTGCTCCCTCCAG
TACTAGGAGGGCCCTTCAAGAAGCACGCCTCCAAGTCGCGAATAGTTTTTATTGGATCCACTATCTTGAATGTTTTAAAAACGAGTCCTTTGAAATAGTC
TTCTAAATGCAGCTCGATCTCCTCATAGCTGGGTAGTACCCGGCAAACCGCATCAATTACGGATTCACCTTTCTTGCATACACTGGGCTCCCTCAACAAA
TTCCATTCATTAGACGAGCCGTAATTATTATTAGTCTTCCAAGAATGGCGTTTTTTTTTAAGCTTACTCCAAGCAGTAGTGAAATACTTGTTAAATTTGG
AATCACAGTGTAAGTGAAACATGGTCCTCATGGAGGTCAACCCGAAGGCAACTGTTCTATCACTTTTCTGAAAAATGAATTTCACATCGCAAAGTGGGTT
TACTCCCCCTGCTTAGCGTGACACACAACATCATCAGTTACATCATGACTTCGAGACAGAGATGTTTGGTACGGAATACTTTGCGTAGATGAAGCACTGC
TGTTGTTCTTGTTGTTGGCAACATAAGAACAATCTTCGTCATGTATACGACACTGATAACACTGAGGTCTAGCATGGTCACACTTTTGTTTCCTTCTTCG
ACAGTTAAGACAGGAATGAATAGTCTTCCGTCTCTTCGATATCTTTCTATTAAGCATTTCGGGGGTGATACAGTTAGCCTTTCAGAAAGAGAAAGAAAGA
ATATAATGTTCGCAAGCGCTTATGCCTGTAACCAACCACCTCCAACCTCAGTCCGTTCATAGAAGTATATTTGCCACATTTTTGTTATCCAAGTATGAGT
TGCACAAAGCCCCAATTGAGCGCAATATGTCTGTTTCTTAGTCATGTCGTAGGTGAAGATGACAAAGCCCCGTATTAGACGACGTTGTGGTCGGCGTACC
CGGCGCAGGCTTGAATGTGTGGGTGTCTTCGTACTAGATGAGAGTATTTGTTGCTGTCATTCAATACGAGTTTGACACCGACGTAAATAGTGACGAGTTA

582,913bp truncated ...