Sign In

S. eubayanus strain FM1318 ( SEUB3.0 ) - NC_030973.1
Saccharomyces eubayanus strain FM1318 chromosome XIV, whole genome shotgun sequence

>NC_030973.1 Saccharomyces eubayanus strain FM1318 chromosome XIV, whole genome shotgun sequence
TCCAATACTCTCACTTAATCATCACTATCCACGGCCCTTACCTCCCCATCTCACGCCCGCCACTACTCCTCTACATACCACCTAACTACTACCGCTACCC
TCCACATATTATACCATACCGACATATATACATCTTTACCCTGATCTACTATCAATACCATATATCATTACCCTACCTCAATACCATATACCATCACTCT
CTCTACCCCATACCATATATCATGATACCATTACTCTCTATATACCATATACCATCACTCTACCCATAATACCATATATCATGATACCATTACTCTCTAT
ATACCATATACCATCACTCTACCCATAATACCATATATCATTACTTTCTATATTCCATACCATACATCTTTACCCTGATCTACTATCAATATAACATACC
ATCACTCTCTATATCCCATATATCATTACTTTCTATATTCCATACCATACATCTTTACCCTGATCCACTATCAATATCATATACCATATACCATATATCA
TTACCCTACTATCAATATCATATACCATCACTCTCTATATCCCATACCATATACCATTACCCTACAGATAATACCATATCCCATACCATATATCATCACT
CTCTATATACCATTACCCTACCTCAATATCCATATACCCTAACCACCACTCTCCCCATCATATCTCTACTCTCCAATCATCCAAACATAAACAATTGAAC
ATGAACATGACCATTCAAACATAAACAAATATACATATCCATTGAATTGTAAACAAATGAACGTATCCATTGAAACATAAACAAATATACATAACCACAC
CCCTCCATAATACCATATACTATAATACCATATACCATACTTTATGCCATACTATATATCTAATACTATTACCACTATATATCTCAATAGCACATACGAT
AATATCTCAACTTTTCTTGATATATCACATACCATATATACTATCATATACTGTCTCTCTATATATTCCAACACTACGGTATACCACATATCATAATACC
ACACCACACCACCACTTTCTTAATAATATCTGTAAACTATATTTCCCTGACTACTCCTATTATATTGAATTCGTACATTTCAACGAACGCTAAAAGAATA
TATCTCATTTTTTACATTTTACTCTACTTTTTCACTTTTCATCAAATATATATACTTCTAATAATCATATATAACGAACACTACATAACTACACCTAAAC
CATAATTTTCCATGCTCTTATTCCCCAATGACATGATTCAGACCCACAGGAAATTGAGCCACCGCATACACCAATCGCTCACTCTACTCATCTTAGCTTC
TCTTAATATTACCACTTACTTAGCCGCCGAGCCAACGCCCCTAGTATGTGCGGCTGAATGCGTCCCGACACGATCATGTGACCCTTTTCAGATAGTGATT
ACCCGCGCCCGAAAAGGCCTTGAAAAACTCCATCTGCAAAGAATATTGATTTTCGGCAACGCCGCTCTGCATAAGACCCGGCGAGAATGGGCGCATCGTC
CCATAAAGGTGTAAGCGGTTTCGCCCATAAGGGTCCACGCTTTTCAACTATTCCATATAGGAAAGATCTCTTGTGCGGCTATGAAAATTTAATATTGCAT
AGCTATTTCTTGTTCATCAAAAAAAGGCACGCTATTTATTTCTGCTTTATATCGTGAAAATTGTTTTTYATACAAATCATTTCAAACAAGTGGCGCAGAC
CTACGTGTCCAGCATCCATTAAAAATTTTGGTGCGATTCTGGCATAACTTTTATGTCTCTATTAGTTTTGCGTTTTTTTAATATTAGTGAAACAAGAGCA
AAAAGATTCTCTTTGCACCCTACTATTCACATACCGAGTACTATCAAATCCCTTTCGTGTTCGACATGTGTGGATGCCCCCCAAACAAAAAGCTGCTGCG
CGGAGCTGACTTCTTTATCTTTTGTGAGAGAAAAGTACTGCAAGAGGGCATCTGGAATTTTGCTGTTCAGGTTAGTACAGTTTCCTCGGAAACACAAGCA
AGTACTTTCAGGCTTGCAAGCATCATTGGAAGTTGTATACCTCTGATCATCGATATGTGATTTAAAGAAAGAGCATATAGAAACAGAAGGCTTTACAATT
CTATTCTTACCTGAAATGTTAGACAGAACTGGTCACGCTGAGAAGCTTCAATCGTTAGTTCAGGTCATTAAACTCTTTTCTCGATGTATTTATTTAAACG
CGGCTGCACTTAATTTGAAATCAAAAGTTCATGCTGGCCTCAAGATTGCATACTTCAAACTATCTCCAGTCTGCCTTGATACCTCCATTTTTAACATTGG
GCTGTTATATTAGTTTGTGTGTGTGTATGTACTAGTGGTTCTGTTTACAGGTTGGTTGGTACGGTGTAATCCTTGAATTTCTTCTGACATATCGCTGGTC
CTGTGGGTGATACGAATTTTCCATGGCTAGTCATGACGTGGAAGCACGTTCGCAGTGTGAAAACGCGCTCTTCCCTTTTTTTCCTTATGTGATTGCAGGA
AAATGCAGTCTACACTCTCAAAGGTTGGAATAGCCACAACTATTGTATTTGATTTTTTTCCACAGTGATCCCGGATATGAGAGAATTTAAAGCTTTCACA
GCGTCCTTAGTATGCGTTTATTATTATAGAACACATACTTTTGTCACTGTACGGCATTTYACAAGTTGAAGTAGATTGATGATCACTACAAAAACCAGGA
TCGCCCGACTGGTCGTCTTGACTGTAATACCCGAAAGATGTATATTTGAACCTAAATTTAGCCTTCGAGTTTGAATGTATGGCTATTGCTTTCGGAAACC
GCAAAAGTACCCCAAATGATCCGGATTATGTATATAGTGGCTGGAGTGTATGGTATATATCTTACCTTACGTTTCTATACGCTGCCCCACTGTTCGATCT
TCCGGGCGCGAATCCAACACGCGTATACCTGTAAGTTATTATTGAGTTGTAACAGTTTACTTTGCACTATCATACCCATGGTTGCGTTTTATTCCCACAA
AATACAAATCAATTTTCTAGCCTTAATTCAAGATGTTACTCAAATAACCTTCAGAAGTAAATCTGGAGGTATGGGAAATTGAACCGTATTTTCTTGTTAT
GTTGGAGCTACTATATTAAACTCGGTAGTAAGGTTTCTACCTAGCGGATTATGCTGAACAATTATGTCAGGCAACTAACTTATCTGTTTTCAAGGAGAGA
AGAAGAGGAATATAGATGATTATATGCCCAAAGGCGTGAGCATTGATGTATAAATAATGGCCAAGGATCATCAATAGTCATGTGTCTACCTTTACACTAC
GGAAAACTTCAGGGATATACAAACAAACAAAAAAAAGGGAAGGCAGACCCGACTGTAACAAATATCACCTTGAACACCAAAACTCTCAAAAACTTCCAAA
CTACTTTTCCTCTCTCAAGTTACCCAAAAAAAGGTGTTAAACAGGTTTTTTTTTCTCATGTCTAGTTACCGCAGTTCCCTTTTAACCTGTTTTCGTCAAC
AGTTTAATGGAGCACCGTCATTTGAGGAGCTGATTTATTGAAGGCAGATGGGCTTATGCGGGATTTCATGGAAGCCCGAGATTTTCTATTCACATTGGCG
GAGAGAGGTCAAAGACACCAACTCCCACATTGCTCCATATAACCGCCGCAGCATCTAGTGAATTGTAATATTATATCAGCACACTCTTGGACGGATGAGA
TTGTATATTTGTATTCTTTCATTCACCCCATACTACAGTATAATACGATATCAGATGCTCTTTACAATCCCACCTTCACTACATTTCTTTTAAAATTCTT
TGTTGCTGTTGATCGTTTCAGTACTTAACTCAAATGAAAGTAACTTGCATTCTTTGTCTCCTTTCATATTTTCCTCGATTGTAATCCTATATATCTAACC
GACACGCATGGTCGCTCAATTCAAAACGAAATTTTATTGTTGGTAAAACATTTTTACATCTACTATCATCTTTTCTTAGTAGTGCTGTAACCTCACACTA
CTTTCTGTAATCATGACTAAAGCATTCTGCGTTGATACAGTGTAAAAATTTTTTAGGTTTTTCTTAATGTACACGCACAGGTTTAGAAGAGGTCGCATTA
ATTATATTGGACAATATATGGTGAAAAGGTTTTGCTCTTGTCTTCGTTTTTTGGTATTGAATTTAGCGGTTAGTGAGTACCTAGGTTATCGACTCACACT
GCGGTTGGCTTTAAAATTATTGGTCTGTTTAAATCCCATTAAACGTATGTAATGGTGATTTAAGGTTCAAGTCAAGATGCAACAAATGATGACAAACGAG
CCACTTTATCTCCACTTTGATGTATACATATTTTTTATTAGCACTTGTTCACCACAATTCAGCAGCCAGTATTTATTTACTCTAACAATATCAATGGGCA
AGAAGGACGCACGCAAAAGAGATTATCGAATAACGATCTATCTCTACCTATGATAAAGGTTGAGAAAGAACAGAAAAACCAGAGAATATGAAGGTATCGG
TTCAGGGAAGAATTCATCCTACTAAACTTTTACGATGTTTATTTCCACTGGTTTATCAACGACATGCCTTTATGATAAATAACACCCACATGATATAATA
TCGTGATAATGATGAGTGAGTTGTTACCCCTTGATTGCATAAAGTTTAGTAGTGAGGAAAAACCATCCCTGTTTAGCCCAAAATTTCAAGCCCCACGTTC
CGCCAAGATATTAAAAAAGAACGTGCATGGGGCTTTTGCCTACATTATGCTAGTATTGACTACATTCCTTAAGTTTTTTGACAGTATCCACCATACTCCG
AGTGCACCGAGTCTCGGCATGATTAATTTTTTTTGCGGCGCCCACGTGGATTGCCAGCAAAGGAAGTGCAGAATCCAAAGAAAGCAGCACGTAGTAGTAG
CCGCATAAAAAATGTTTTACTGACAGTAATATGATATTATAATTGGATTCCGCAATCTTCATATTTATTTTTAACGCCGAATTCATTTCCACATTCATAC
ATGAACCTTGAAAGGCCCCCACTTGGAATGTATTGATTGCATAGACATTGGTCGAATGGTGTATTTTGTGGCATGTTTTTTTAGCTTTAGTCAAGTACGT
CCTTAAATTCAGCTAACTTAATTTCTTATGGCGTGGGCATCTTTTGAAAGAAAATACAATTGAATAAATAAAAAAAATGATGAGTATATAAAGCCAATAG
ATGTTCATCGAAGTAGTACTTGTCTTCTCTTATGATTAGGTAACCAACTCCAATCAGTTATCTATAGTTGAAATATAAAAGTGACACGAAATGGAAGATA
AAGATGTCTCTTCGATACACGAGAAAGAAGTGGACGAGAACAATAATCCTAGATTTATAGAATATGATGCCGAAGGTCGTGCTACTCGTAGTGAAACTAC
TAAGAAAGAAAAATGGAAAAATATAGTTACGATTATTGCATCTGGTTTCGCTTTAATTAGTGATGGTTATGTGAATGGTTCAATGAGTATGTTAAATAAA
CTCTTCGTTATGGAATACGGAAAGAAAAACTATAGTTCAAGAGTTTCGACAAGAGTTTCCAACGCATCTCTGGTCGGTATTATTTTTGGTCAATTTTTTA
TGGGTATTGCTGCAGATTATTATAGTAGGAAATCATGTATCCTTGTTGCTACGACTATATTAGTTCTTGGTAGTGCTCTGTGTGCCGCTTCACATGGTAC
TACTGTACCTGGTATGTTTTGGATGTTAACAGTTATGAGAGGTTTGGTAGGTATCGGTGTTGGTGCAGAATATCCGACAAGTACATTAAGTGCCAATGAG
TCTGCTAATGAATATACTACAACCAATAGAGGTGGTATCCTGGTTATGGTAACAAATCTGCCACTAGCCTTTGGTGGCCCATTTGCTTCGATTATTTTTT
TAATTGTCTACAAAATCTGTTCAGGAACGAAACATTTAGAGGCGATTTGGAGAACTGTTTTTGCTCTCGGTTGCTTCTGGCCTTTAACAGTGTTTTATTT
TAGATGGAAGACTGCTACTACAGAAGTTTATGAAAAAGGTAGAATCAAAAGGAACATACCGTATGTTTTAGCTTTAAAATTTTATTGGAAAAGGTTACTT
GGTACATGTGGCACCTGGTTTATGTACGATTTTGTCACCTTTCCAAATGGTATTTTCAGTTCAACAATTATCAGTTCTGTTATTAAAGATCAAAATGATT
TGGTAAAAGTTGCTGAGTGGAACTTGCTACTAGGGGTTCTAGCTGTATTAGGTGTTCCAATTGGTGCTTATTTGTCAGATCGTATTGGTCGTAAATATAC
ATTAATTATTGGTTTCTCTGGATACATCATCTTTGGCCTAATCATAGGTTGTGCGTACGACCAATTATCAAAAATCACCCCACTATTCATCATCTTCTAT
GCGCTCATGAATATGTTAGGTAATGCCGGACCAGGCGATATGCTTGGTGTTATTAGCAGCGAATCATCAGCAACCGCTGTTAGAGGTGTTTTCTATGGTA
TATCTGCGGTAACTGGTAAAATCGGTTCTGTAGTGGGTGTTGAATGTTTCCAACCAATCAGAGACAATTTGGGTGCAAGATGGACATTTATTATTGCCGC
AATTTGTGGTCTTGTTGGTGTTCTTATTACAATTTTCTTTGTTCCACATTCGCTCGAAAATGATTTAATGAAACAAGACGTTGAATTTCATAACTACCTA
GTATCCAATGGCTGGACTGGTAAGATGGGATTTGATGAGATAGACGAGGAGTCTGTTGTTAAGAGTTTTRAAGATGAAGGTAATAGTACTGATTGTAATG
AGAAAGCTACCGAGATAATCTCAGTCAAACAGGTTAATCAAGGTTAAGTTTTATAGATAACCTCAACACGTGTTTGTCTGAAGTATGAGTTTTAATAAAC
CATCTGCTTATGCAACATATTTGAAAGGTATGCTTACTATTGAGGTGTACTTATGATCTCTTAAATGAAGAAAAAAAAAAACATATGGTACTCCATGCTT
CTTTCTCGTTCTGAGCATTTAATATTTATAGGAATTAACCCATGAGTTGATTTTGATTCTTAAATTTTCGTATCATATTGCTTAACTTTTTTTGCTCTCT
AAACGATGCTGAAGCACATGATCGTATCTGGAAGTAAACATGGCCGTATTAATAATTGTTTTTGCTGTTCTATTATATATACGAAATATGGAATAACAAT
ACTGAATTCCCAGAATTACCATTATATATAGAAGTAGTTACTAAGTCTAACACATTAATCTCTTTCTATGACACATGTATGACACAGAGAACTCAATAGT
AAGTACTACGGATTGGGAATGTTGAGATTAATCGTACTGACATTCAACATACCACCTCCCTCTCTATGTAACATACTATATTACCTTAACTATCCTTGAT
ATATTATAACACAATATATCATCAATATTTGCCACCTCAATAACCTTGTCTTACACTATAATACCAACCCCCTCATTACCCTGACAACTTTTAAGTTCTT
TGATATTCCACCGCTCATCCCAATATAATACCATATACCACCACATTGCCCTATATATCCTAGCCAATCCTCAATACCAACCCTCTCAAATGTTATCAAT
ATTTCCTACCTCAAGAATTATACTATTACATTTATTATGTTTTTCATAAAATATCATACATTAATCAGTTCCCGTCACTTCTCTCGGGCACTAGAATGTC
TCCTATATGACTACCGCTTACTTAGCCGCCCAGTTAACACAACTTCCAAATACGGCTAACGCTCTTTCTCGGGTAGCGCGATCCGAGAAGATCATGTGAC
AATGTCGACTAGTCATCACCCGCCCGAAAAGGTCTTGGAAAACTTGTCGGCAGAAGACATCATCGGGCGCGTGAAAAAAAAATTTCTAATTCAGGAACAT
GGGCCGGGTACGCTTGGCTTTTTTTTGAAGACCCTATCTAAGGTACATCGTGTTTTATGTAAGTTCCGCAGGAACGCCTCCCCTTTGTGCCTGATGTGCC
GGATCCGCCCAGAGGCGCTTCGAGTGGAACTCCATTCTGACCCTACTTACTGATGACTTACTTTTTCTAAATATTAGCTGAGCCATCAACCGCCCATAGT
ATGCACTAAGATTTGATTTCTCCAAAGTATATAAAACAGTCTACCAGGCCTTGCAAGTTCAAAAATAAACCTCCAGAACCACCCCCATCACCAATATGGA
AGACACCAAACTCGAAGATGGAAAAAGCGTAGGCTCATATCATCTAGATGTGTTGAGTCCCAGAAAATCGTATTACTAAAGCACATCTTTAGAAATTTCT
TTACTTGGTTCTGATATATGATTTACAAGTCCCTCGCGTTTCATATCCGGCTGATATTGTGGTTACCGCTCGGTGCTTAGTGAAAATTATCCAGTGTTGA
CTTTTACCCTTTTATAGATCCATGTTTATGCTTTTAGGGTTATTTTTTTACTCCCATTATTCTAATGATAAGTCGTGAACGTACTTTTTCAAAACAATAT
ACTCGGTTTTGCAAAGAAATGATTGAAAGTGCTCCAGGTACTGACACCGAAGACTGGGAGTTTATTGTAGTAAACCTCAACTCATACATGTATGAAAACA
GACTTTGGAATAATAAGCACTTTTTTTTTTGATGGTCAGCGTTGCAAACAATCATTTAGACTATGCATTCTAATTCCGTCCTCTCTAAAAAAAGACAATG
ATGCAAAGGACAAGTCATTTAAGGAGTCAGTGCCATACATCGAAGAGGCTTTGGAGGTTCACTTTGCAAAATTAGATGAACGATTGAACCAGAGCTGATC
AGAAAAGACATTGAGTGCTATTAACTTAGAAGACATTCTACTTCCTAAGCAATCCTATCGTTTTGAGGCTTTTTGGACTTTTAAAACAGCTATGAATCGC
CGTTAATTTTTGACGGTAATCTTACTTTGCTTATTCTTTATTTATCGTTCGCGGATATCAAATATTTTCGGTCATATCCTTTATCTTGGTTGTATTTTCC
TCGTACTGGCAAAAAGTTTCCAAAACTCAAGAACTGTACCAATGAAAATTGAAGACAAGATGCAACATCTTTTAGTTATTATTAGTAAGCAAGAAATAGG
TGCTAGCGGATGGGATGTAATCGCAAAAAAAAACGAATGTGTATTTGTTTGAGCGGAAAGTGTACAGTAACAAAGAGTTTCTCTTTGACAAAATTGCTTA
TAAGAGGTTCTTTGGCTGTAATTTTTCCAGTATTTTATCTTCAAAGAAATCTGTGCTACATTTGTTATTAAACGTTGAACTATGGCCATATATTAGGGGA
GCGCAATTGGCCTGTGGCGATGAGTATTCAGCGTAGATATCGATGTGTGCTTTTCGATTTAGAATTCGTAAAGATCTAAAAAAACATCAATTTTCTTTTG
ATTCACTGATAGCGGGAATATGAGGCGTGCCATCTATGGAAGCCGTGTCATTCACAACTTTTTTCTAACAATCATACATAGTATTAATTGCGCCACCTGA
AAATGATTAAAAAGTGCTTCATTTTTTTTCCATTTCAATTATTCTCTCTCATTTTTTCTCTTCTGATATTTCAGCAAAACATTGAGGTGCAGTGACATTT
CTATATGCTCAGGATTTCTTTTCTCTCTCCGTTTCTAATGAGTGGTACAATATTTATACTGATTGCCCTAAAAGATGGAGCCAAACTTTTCTCTCAGAAA
TTTGGATATCTCTACTTCTTCTATAAAAGCTGTTGGGTTGGTAATCACTGCTGCTTATCAAGAAAAGGTATTACAGTCTTACCAACACTAAATAATAAAT
AAAAACAGTACTTGTATTATACATAATTTACTGCCCAGCTATGAAGGAAAATTCCACAATGTTATCGAAAGTTCAGAAAACAATGAAAAGTGTGTTTTTA
CCATTATTAGAGAATTTTAAGAAATAATAAATCACTGAGGTAGCCGTATCATGTATCCGGTTATTGTAGTGACAAGAGAGTGCTGCTTTAAATCAACGTA

762,019bp truncated ...