Sign In

S. eubayanus strain FM1318 ( SEUB3.0 ) - NW_017264705.1
Saccharomyces eubayanus strain FM1318 plasmid 2 micron, whole genome shotgun sequence

>NW_017264705.1 Saccharomyces eubayanus strain FM1318 plasmid 2 micron, whole genome shotgun sequence
TAGTCGTAAAGCTTGCTCATATTAGGCGTCAATATTTTTTTCCAAGATACCACTAAAAAAGTATCTACGGAGCGATCCTAAATCTCAATGTTGAAGCACA
GGTGCGATGCGCGCGCAGACAAATGAGAGTAGCGCACCGCCAGTGTTTATGCGGTTCTCGAATAAATCGCACCGGTGCGATTCTCGCAAGAACGCGAAAC
AAAAGAGACAACCAAAGTTAGTTTTTCGAAGTAAAGCATTCGAATACAGCAGTAGACAAGAGATATAACACAGTTAAATTAAGTACCAACTGAGCCCAAG
CTGAGAGTCCAAATATGTCAAAATTTGATATACTATATAAAACACCGCCTAAGGTGCTCGTAAGCCAGTTTATTGCAAGATTTGGGGAGCCTTCCGGTGA
AAAATTGGCCTCATGTGCTGCGGAATTAACTTACTTATGTTGGATGATTACACATAATGGGGCGGCTATCAAAAGAGCTACATTCTTGAGCTACAACACT
ATCATAAGCAAGTCACTACAGTACGATGTTGTTAAAAAAACACTCCAATTCAAATATAAGACGCAGAAGGCGGCCATTCTGCAAGCCTCATTACAAAAAT
TAATTCCAGGTTGGGAATTTACGATTATACCTTATTATGGACAAAAGGAGCAGTCTGATGTCACCGATATAGTTAGTAATTTGCAGTTACAGTTCGAGTC
ACCTGAGGAGGTGGAGAAAGGTAATAGTCACAGTAAGAAAATGCTTAAAGCACTATTAAACGAAGATGAAAGTGTCTGGAATATCGCTGAAAAAATACTA
GATTCGTTTGAATACACTTCGAGGTATACAAAAACGAAAGCACAATATCAATTCCTTTTCCTCGCCACCTTCGTTAATTGTGCAAGATTCAGCGACATTA
AAAATGTTGATCCACAATCATTCAAACTAATCCAAAATGAATACTTAGGCGTAATAATACAATGTCTAGTAACAGAGACGAAAACAGGAGTTAGCAGACA
CATATATTTCTTTAGTGCAAAGGGTCGGCTCGATTCGCTGGTATATCTTGATGAATTTCTAAGGTATTCCGAACCTGTCCCTAAACGAATCAATAAGACA
AGCAGCTCTTCAGGTAATAAACAGCAGTACCAACTATTGAAAGATAACCTAGTTAGGTCGTATAACAAAGCTTTAAAGAGTAATGCACCGTATTCAATCC
TTGCCATAAAAAATGGCCCAAAGTCTCACATTGGAAGACATCTAATGACATCCTTTCTGTCGATGAAAGGCCTAACAGAATTGACTAATGTTGTTGGGAA
CTGGAGTGACAAACGCGCTTCAGTTGTGGCCAGAACAACGTACACTCATCAGGTAACTGCAATACCAGACCATTATTTCGCACTAGTTTCTGGCTACTAT
GGATATGATCAAATATCAAAGGAAATGATACCGTGGAAGGACGAGACTAATCCAATCGAGGAGTGGCGGCACATAGAACAGCTGAAGGGTAGCACTGGTG
GAAGTACCCGATATGCCGCATGGAATGGGATAATAGCACAGGAGGTACTGGATTACCTTTCGTCCTATATAAGCAGACGCATATAAGAAAACATCTAAGT
AAACATGCTACCATTTGAATACGTATATTTACCCGTCACAGGTGCGACGTGGATAATGAGGCGAGAACGCGCAGCTCGCGTCGCACTTCCCGGAATGCTT
ATTTTCAAAGCGCTTTGAAGTTCCTATTTTGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCAAAGCGCTTTTGAAAAACAAAACGCTCTGCGGCTCC
CTTTTTGAAAAACAAAATGAACCCCAAAGCGCTTTTGAAAACGAAAGCGCTCTGCGGCCCCCTTTTGAAAAACAAAAGTGCGTCCCTCCATGGGCACCAA
CATGTCTCCATACTAAAGGCTCAATTGTTTGTGCTATGTACTTGCCTATATACACACCTACTTATTACTCTTCTGCTCCTTGAACTTGCATCTAAACTCA
ACTTCTACATCAATCGGCTCCCAATTGTCTCCAAATTTTACTGTTAAATAAACCCAAACGGCTGTGATATGCGCCTCTTCATAATGCAAGCTTACCTTTA
TAGAATGGTGTGTAAAGCTACTACCACGATAAACCTTTACAGTCCCCTGAGACTGAATGAGTTCCTTTAAGATGTGATACAGTATATTCTTGAACTTTGC
ACGGCGAAGTTTGAGGCTTGCTATCCTTTGATTCTTTCCGACGATTCTTTCTGCCAATTCCTTTGCCTCGGCTTCGTCTTCTGTTTCTGACTGCCACGCC
ATACACAATAAATCTACATCACTCCACAATTCTTCATCAGCTTTCACATCTTGTTCAGTCAAACTATTGCTTTCATCTTGTACATCGCTCACACCGTTAG
ATGGTTGTTCTTCCACAGGTACTTCCTGCCCCTCTTCCAGATTATCAGCTGGTTCTTCTATATGATTCTTATCCTGTTTGTCTTCCACATATCTGGAAAT
ATATTCATGTACTATGGAGTTTCTAATTACATTCTTCAAGGCTGCAAAATTTGGACCAGATGGCCAGTAGGCTTTACATGAAAATTGCAAAACAAATTTA
GTATTATTGTGATATTCTGCGACGATTTTTTGGTAGTCTCGAAGAAAGGAAAAAAACGCAGTAACCTTATTATTGACGTAAGAGGACTCCATGTATTTGA
AATATACACCCTTGGGCCTCCTGATGCCCTTTCCCCTACGGCCAAGTGTATCTTTAACACTGGGGTCTAACCCCTGTCCAATAGCATCCTTTAACACACT
CATAAATCCAACCGATACGAAGTGTGCTAATTCTGGGTGATTTATTATGCGATCTACGATTGTGTTATACACTACGGCAGGATCGGGCCAATCCACTCCT
TTTTCAATCAGCGGTGTGCTGTCTGTATTTAATAGGTGTCCAACGAAAGCAAACGCTAAAGGTTTGTGCTCCCTATAATCACTAGGGACTGAGAACTTTC
CTCTCGGCGTTTCAATTACGTCTGTAGCATCGTTGTATATCATTGGTTGGAAAGAAGGCATAATACATTGCTTAATACACGCAAGCAATCGCTCGCCATT
CATATTTTGGTTATTTATCAGCAGATCTAGTGTGCACATCAGCACTGTAGATATTGATCTCATAAAGGAAGTTTCCGCGATTTTGATGTACGAAAATTTT
GAGACGGGACCGAAGGAACACTCCAGCTGCGGGATTGAACATTCGGGGAGAAATTAAAGCAACGCGACTGCATTTTAGCGTAAAAACTGCATGATTAACT
CCAAGATTTAGAAGCAATTGCGGTTAATTTTATCACATATATCCCATCAAATCGTGCATTGAATGCCTATCGAAACACCGATAGACTGCATAGAACTATT
AGCTACTCAATGCTTTCTACCAAAGCTGACCGACAGTGAAGTTTCCAATTTTAAAGACGCTTGTAGTAAAGAGAATGACATTATAAAGTTAGCACTTAAA
GTTCCATACGCCGTCAATTATAACGACATACTACATATATTATATGATACGCTTCCGTTCAAATCCCAGTCTTTTAGCGAGACATTGCCGCTCTTCTATT
ATTCTACTGATTCCGTTCGACAAAGGCAGTGCGATTTAAGGTTCTATCTTCGTGATGCAATAAACTTGGCTACGCCAAGAAAAAGATCAGAAATGCGGAA
TGCCCTTACACAATGGCTACCGTCATTATTATCCGATGTGACGCTGCAAGAACTGAACGATATTCGAATGAGTGTCGAGGAAATACAGCCTAATATTCGG
CAAGTAGTTCTAGAGAATTACCCACATACCCGTTATCCATCATTAAATTTTGAACGTCCCGACTTGGGATTACAGCCTGAAGTAGACAAAGTTTAAACGA
TATGATATACTTGAAACCTGTATAATAATGATATACTCTAATGTTTTTAAAGAACTTATATTCTTTCAGAATAGCAATCAATATAATAACGCATTTATGT
TTGTATGCCTTCACACGTCGCATTCGAGATGCATTTGTGATCATATGCTTTCACACGTCGCATCCAAGATGCATTTCTATTTTTCCACCATCGCATTTAC
AGTTCTTTTTAATAGTATCTTTTTTCACGATCGCATCTGTACTCATCTTTTTTTGTTTTTTAGTGCATCTCACAGTGCGTTTTTGAAAAGCTATCGCACT
ATCGGTCCGCTTCTATTTTCAAAAGAGATACGGGTCATGCAATTTGTTTTTCTTCAAAAACATCCTAGATCCGAAAAGTAGATTTTTCAACCATAGCGAA
GCTATAGTTGCACTCTCTTATCCCGAAAATGCACTGCGGGTCATATTTTAAATATTAGGCTGCAACAAACCTTGCATATTTTTTCAGCGGAAAGTGCAAG
CTTGGTTTGTTCCACACTAGTAAACAAATCAAAAATTATCTGATCTTCTAACAGATATATATTGCATATTAGTATGTAAGGAATAGTTGTAGGCCCTGAC
TTATAATATCATGATTATAGCATTATCATTTGTGATTGTTTTCACTTGTTTAGTAAGAAGTTTTAAATGATGTACTTGTGTGACTAAAGTATAAATATAA
TAGTCCATACTGAAAATAAACATTGATGTAGAAGTTGAGTTTAGATGCAAGTTCAAGGAGCAGAAGAGTAATAAGTAGGTGTGTATATAGGCAAGTACAT
AGCACAAACAATTGAGCCTTTAGTATGGAGACATGTTGGTGCCCATGGAGGGACGCACTTTTGTTTTTCAAAAGGGGGCCGCAGAGCGCTTTCGTTTTCA
AAAGCGCTTTGGGGTTCATTTTGTTTTTCAAAAAGGGAGCCGCAGAGCGTTTTGTTTTTCAAAAGCGCTTTGAAGTTCCTATACTTTCTAGAGAATAGGA
ACTTCAAAATAGGAACTTCAAAGCGCTTTGAAAATAAGCATTCCGGGAAGTGCGACGCGAGCTGCGCGTTCTCGCCTCATTATCCACGTCGCACCTGTGA
CGGGTAAATATACGTATTCAAATGGTAGCATGTTTACTTAGATGTTTTCTTATATGCGTCTGCTTATATAGGACGAAAGGTAATCCAGTACCTCCTGTGC
TATTATCCCATTCCATGCGGCATATCGGGTACTTCCACCAGTGCTACCCTTCAGCTGTTCTATGTGCCGCCACTCCTCGATTGGATTAGTCTCGTCCTTC
CACGGTATCATTTCCTTTGATATTTATGCCGTTCTAAGACTCTTGCGCGGTTTCCTACCCCTCCCTCTCTTTGCTGCTCCTCTTGATTTTGCAGGAGTCC
CTCTAGCTCCCTCAGTGGCGGCTTTATATGTCTGTCTTGCATTCGCGTCTTTACTTCTTGTTCGTTTAGAAGGAACTTCGTTGACTTGATTGGTAGAGCT
TACTTCAACACTTCTATCTTCACTGTCCTTTCCCTGTCGTAGATGTTGCTGCACAACCAGAGTATTAACACTATTAAATACCCCCCTGAGAGATTTTGGA
ATAGGTAAATCCTGCATTAATGCAGCTCGGCGATCGGGTTCAACCAGAGTCAGGAGTTCGGTGACGACACTTAGTAGGTTCATAACTTCTTCATTCGTCG
GTACGGGTGGAACTAACAGTTCTGCGCAATCCACTGTTTTCATCACAATTTCCATAGCTGTTTTCTTGGCCTCGTTTGGCAAGGATTTCATTATAGTAGC
AATAGAGCTGCGTAATTGCTTTCTGTCAGAAAGTAGCGTGTTGTTTTGTAGCATCAGTTGCAAGGCAGCCTCGCTTGCTGCTTGTGAAGATAACATACTA
TTTCCAAGTATATCAAACCTCGATTTTACTATCTCCGAAGCAGGCATGGTGACCTCTGTACTGGAGTCAAGTGTATTTGGGGCACTTTGTGAACCGGGAT
CAACACCGATCGGTCTACCAGATGTGAGAGATTCCATGGGTTTTACTATATACCCCGGGAACAGTAGCTGATCAGACATACGTTTACTCTCTATATCAAT
ATCTACATCAGGAGCAATCAAATTTACCAGCAACCGGCATACATCCCACACGCTATAAGCAGTTTGGACTTTTACAGTCAAATTCTTGGCAGCTTCAATA
TCCTCCATTTTGGTTTTCCCTTACCATTGGTATTCGTTCAATGATGCATCTGCTGCTTATT

161bp truncated ...