Sign In

S. eubayanus strain FM1318 ( SEUB3.0 ) - NW_017264708.1
Saccharomyces eubayanus strain FM1318 chromosome Unknown, whole genome shotgun sequence

>NW_017264708.1 Saccharomyces eubayanus strain FM1318 chromosome Unknown, whole genome shotgun sequence
ATGATATATGTTTACAAATGATATGTTTTCCAAACAATCGCTGTTTATTCTACTATTTTTCAAAGAATGAAGACAAAGAGTCGTTTATCGCTGTGTAATG
AGGTGATTACAACAAGTCGTTGAACCGGAATAGATGCAGTAAAATCGTCATACATACAATATGTTCAAAAAACAACTTGCGAATTTAGAGAAAACGCGCT
ATACTCTTAAGACTAGCTGAGCCCATATCTCCTGCGACAAGCAAGACTTGCGGAAACCTTCTTGCCTCGAATAATATGGAACCCTTCGATGACGGCAACC
CCTTGTTACAAAGTTCCAGAAATATTTGCCACACGTGCATTGAATCCATGTACGTGTCATTAGAACATGATTTCACACCGCCTTCACATCTCCATACTAA
CATACGAAGCTTTCCAATAATGCACTTGAAAAGTCTTAACCTTATCATCACAGATAATTTTATGAACTATCAAGAACTTTCTCTAGCTTAATGTGTCTGT
ATCTAATAAGATATATGTCCCCGGAATAGGGAATAGAGTAGATATGTACATAAATATAAACTTTAAAAATATAACAAAATGAATTGATATTATTTTTGGA
CAGCACCAGCTTTTTATAACAAACATCTAGCCTTCTTCTGACTGTAGTAGCTATCATACAAACAGGAAGAATAGCATAGCCAACAAGAACAGCAGTTCCA
TACATTTTTTATGAATAATTATTCATGCTACTCCGAGGTTACCCGAAATATACTGCACTGACCTAGTATATATAGAACCCATAAAATATCGTTCCATTCA
TACATGCTATTCCATCACTTCTACGTGTCAAACTCCTCCACTGCCATTCAAGCATATAATTCCATCTTCTCTTATTTAATATGCGGCATTACCCTAAGCA
TATCTGGCGCAATTTAAAAATTCAACTCTTGAAAATATAAATTGTCAAAAGGCCGTTTTGTCCGCTGAGGTCCGTAATGTTTCCCTGGAAAAACAATACC
TGTTCTTTTGATCCATATACCATTTCCTTACCTCTTTTGAAAGTTCCTTTGGCACATTTACTAAAATGTAAACTTTTCAATAATGAGTAATGAACAAGTA
TACGCTTCAATTTTTTGCAATAAATCACTCTCTATGCCAAACATACAGGATTGCTAGACGAGAACTTGCTTAGAGGATTTGTATATAGGCGGCCAACCAG
GCTCAAGTGGGAATAAAGTTAGCGGTGAATACAATTATGCAGGCCTTGTTTGCTTCGAAAGTTCAGGAAACAATCCACCACCATCCTCAAAAAGTATAAC
TTCCATGTAGTCAGTCGTGTGCCAAAATAGAGATGAATTTCCAATGACTGGCTGCTCTAGTCACTACAAGTTCATTTTCCAATAAAACGCCATGTACCAG
GAGAATAAGCTACACTAAATCAAAATCAGCGTGGTCGATTATGACATGTTTCCTGTTTCTTGGTGTACACAGTTTAATACGCAAATCTCTCATAATGTTG
ATTTAGTTCGGCTATGCCGATAATGTGACAGAAAATTAATGTTTGTATTTCTTCGAAGTTCGCATGAGCAGGTGCCTTGTTCGACCTTTATTCAGCCTTT
ATTTGAATACTCGTGTCAGAGTTGATACTTCTTTGCAACTCAACTGCGACGTTGAAGTTTTTGTTATTGTTTCTTATATTAAGCGCTAAACAACGAACGA
TGCTATCTTTTTACATGCTGGTATATATACATTGGTTTCCAAAGCTGTATTAAATAATACTGCCTGATTTTTTTAAGAATTGACAATTTTTTCAAGAATT
GACAATTTCTTTAACTCTAAATCTATTTAGAGATTATGCACATTTTTAATAGACCTGTCCGGACCCAAACGCTTATAAATATTAGGAGGAGCAAAGAAGG
TACTTGATAAAGCTCTCGTTAAACCGGTACCTACACACGGATTATTCGAGGTAATTGACATACATTTCCGTTTCTATGCGCCGATACGTATACTGCCTAT
TGCAATGATTCACTTGCCTGTCTCACTATATTAACTTTTTTCCAGTCTCTTTTCGAGCAGGCAAAGTATTCATAATTTCAACACTAATCTCTAGTTACCA
GTTTTGAAACTCTTCCACATATTCTATCCATTTTTCGCCATTATCAACAACCTTTTTTGCAGTTATTTCCCGAGTTTTGTCTACAAACCCTTCTGAGCCG
CAGCAAACAACCAACAATGATTTTACTCCATTCATTCCTTCTTCGATTACTTCATCGATTTTTGGTCGTCCAAAATTTGTAACTACTTCCACTGACTCCG
AACCCGTCAACAGTCTACCTTCGATATTTTTATTGGCGGCGGTATCATCTTCCACACGCAAACCATCTTTCTCCTCCCCTGTATAGTAAATCTCCACATC
CACCTCCATCTGTTTCAACACCATTATCTCTTTTTTGTACACTTCCAAAAGCTCAGCATTTCTTACACTCCATACAAATTTAATCGTCTGATTATCATCG
TTCTTTCGTTCCCGACCCGCCTTTATCGCCATAGACAGAGGTCCTGGAACCCCTGCCCCACCAGCAAAAAATAATAGGCTTTCAAATAAGTGCGTTCGAG
TGCTCTGTCCGTATGGCCCCTCTACTAGAACTCGCATTTCAGCATACTCCTCATTCTGCAATATATAGTCCTGCAATTTTTTTGTCAGTCCGTTCTTAAT
TGTTATTACAACAACTAATTCGCCATCCTCAACCAGAGAGTCCATGACTGTGAACGGATGTGCCTGCCAGAATAGTTTTGGTTTTAAAAACTGCAGGTAG
ACATATTGACCAGCCTCAGCTTTCCAACTTTTGGAACTCTTTGCAATTCTCACCTCTATCATCGACTCACCGTACATCTTCAACTTAGCTAATGGCATTC
CGAATATCGCAATCTTTATCAATCGCAAAATGCGGTCACCAATCCAAAATACTGCGCACGCTATCACCCATTCACTCCACCCGAGTTTGTGGCAATGTTT
CAAGGACTCCTGGAAGAATTTTATTGCCAGAATGATGTGTACTATAACAAACAACTCGTAGTAATGGCGCCTGAAGAAGAAGAATGAGAAGAACACAAGT
ACTGCCACAATAATCATGGCATGTCTTCCGGACGTCCATAGATCACTGTATTTGACGTATTTCCAATAGTTCTCTATGTACGCATGATACGTGTACCCCA
TTGCGTGAACCATACAATCTACCAACATAAATCTCCCTAACCATTTGTGGTAAGTTATGAATGACGTATACCGTATATTTGTCAACCAAGTCATTATACT
GTTCCTGCCGCCAAAGAGTACTATCAAAGGAAAGTGCGCAAATGCCAAGATTCCTGCTCTGTCTGAAATGAAGATGAGCATTTGGCTTCTGTGATCGCTA
AGCAGCTGATTGGAGTCAAAATTGTAAGTGCTCAGAAAAAGTCCATGTAACAAAACATAACCGAGTAAGATAGATGTCTCCAACCTAGTAGGGACTAGCC
CGACGAAAAACCATTTCCCCACAAACATAGCATGGTTGTGAATAAGTGCTGGAAGAACTAAGTGACCTCGCAGATATGCTGACACCTTGTTCTTAAAAAT
CGTTTGTTTAAGTCGTGAAAAATTCAAGAAATTGTACACAGTTGCAATAAACAGAACCCCTAGCCAGTACAAACAAATCGCTCCTCCGTATATATTCCCC
TTGTCTAAGTTATCCAACGGACCGAAATAAGCCCATACCCACTTATCTAGAGAGGTCTTGTTAGGAATAATGGGATATCTTATTATTTCCTTTGCCTCGC
CAATAGGCCGGATGAAGATAGACGCATTAGAAAGGATTCGATAAAATTCATCATTACTGATAGTTTCATCTTTCTGATAATCCCGACAAATCTGGTTTAT
ATTGTTAAATGTTTTTTCAAATGTTTTTTTGCTTTTGTTTTTACTGGCGAGGACTTCCTTCGCGCAATGTAGCCAAGAGCCTAATGCGGGCTCATAAGTG
CAAATAGAAGCGTGGTGACCCTTAGCGTCCGTATCATACTTGTACAATTCCAATTCTTTAGCACAAGCATTAATTGCTATCAGATCCCACTGTGTTCTTT
TTTTACTTATTTTCGGCTTTGCTACACAACCTGGTACCAAATACACCAGAAACAGTATTAACTTAGCTAAAAGCATTCGAGATCTGGGTGAAATTAACGA
CTCGCGACAAGTAACAAAACCGACAAATTGACAAATCGACGTATTGACAAATTGAACATTTTTCGAGAGAAAATTGGTAGTCTTTTTTAATGGTCACTAA
ACCCACGAAAATTTCAAAACACGTTAAACGAGTTGAACGGTGAATAGCCGTGAATTTTACTTACCATACGGTTATTACACCCTTCTAGTCCTAGCTATGT
CCTGCATCTTTTTCTGCACCCTGTTTGTTCCGCGCCCCGCGGTTCCGTTTTTGGTATTATGCAGATGATAGACATCTCAGGGCTCAAGAGCCGAATTCCA
CCACTCCATGAAAGGGTGCAGAAAATCGGGCCCAAGACATAATTCGAGGCCAGTGTACCTTTTTTGAGCAATGTTTACGGGGTATTTAAGCCAAGAACTA
TTTGAACTATCAAGTCCAAACTGATACCTAAACTAATACAATCAAGTTCTTCCACTCGCTTAAAACCAATAATAATAATAACAAAACCTAAAAATGAAAT
TTTCTTCCGCTCTAGTCCTATCTGCTGTTGCCGCTACTGCTCTTGCTGAGAGTATTACTACTGTCATCACTGCTACCAAGAACGGTCACGTCTATACCAA
GACTGTCACCCAAGATGCTACTTTCGTCTGGGGAGGTGAAGGTTCTGCTGCCACTTCTGCTGCTGAATCCTCCGCTGCTGCATCCTCTGCTGCTGTAACT
TCTGCTGCTGCAACTTCTGCTGCTGCATCCTCTGCGGCTGCTGCATCCTCTGTTGCTGTCACTTCTGCTGTTGCAACTTCTGCTGCTGCAACTTCTGCTG
ACGAAGGCTCTGGTTCCAGTATCACTACTGTCATCACTGCTACCAAGAACGGTCACGTTTATACCAAGACTGTCACTCAAGACGCTACTTTTGTCTGGAC
CGGTGAAGGCAGCAACACTTGGGCACCAAGCACTTCCACCAGCGCAGAAGCTACATCTTCTGCCTCAAAGACTTCAGCTACCACTGTTGCAACTTCAGCT
ACCGCTAAATCATCCACTACTGCTCAAATCTCAAGCTTCACTGGTGCTGCCGATGCTATCACTGCTGGTACTGGTTTGATGGGTGCTGCTCTTGCCGCCG
TCATTTTGTTATAATCGATGACAATAACTCTTCGGATACCTGGGTTTTTTTTATGAAGCTCTCCGTGGCTTTACTATTTCTAAAGAAGTCTGATTGAATG
AAATATCTTATAATAAATTATACTACATAATTTATAAGTAAGAATTTCAAACATGATTTATTAAGTATTATGTGTACTGTTTTAAGTTCGTTGGTGTTGT
TTTAATTGCTTGGAACGGTTAGGTAAATATATACACATATATGCATATGTAATGAATACACCTAATAAAAAAATCTTATAATAAGCTATTAGCAATGACT
TAATAAAAGGACCTGTTATTCATCATAGAAGATACATTGGAAACAAAAGTTTTGCTTATTTATTGTTCTTTTGAAAAAGGGAGGTTTATTTAATTAGTTT
TTCATTGTTGAGATATAAATACGCTATACATGATAACTAATGGGTTCTTGTCGGTCGTGAAATCAATCTATAACCAGAAAGAAAATAAACCAAGAGCTAG
TGCACCAACGCTTGCACCCTGGAAAGCAGCTGGAGCAGCACCAGACGAAGAGGCAGACGAAGAGGCGGAGGAAGCCGATGAAGAGGATGTAGATGATTCA
ATTCCTTGGGTAACAGTCTTAGTATAAAGATTGGTTGATGATCCTGAACCATTTGTTAAGGTAAGTGTTTTTGTAGTACTCTTTTCAGAAGTGGTGTCTG
GACCTTCGGTAACAACCTTGGTGTAAACACCAGCACTATTGCTGACAACGACGGTTCTAGTGGTACTGTAAGTAATGACAGGGTCAGCGGTGTCGGTGAC
AACCTTTGTGTACACGTTGTTACCGTTAGTGACAGTAATAGTCTTGGTGGTCATTACACTTGACACATCAGCCGCCAAGACGGCAGTCGCAATTGTAGCA
GCTCCGAAAATAGTTGAAAATTTCATTATATTTGCTTTGTGTTAGCTTTATGATGACTTTTCAGACTGTGATCGGAAGAAACTATCTGTGTTACATACGG
ATTCCAGTTTTATACATACATCGCCAAGTGGTATAAACGCGGATTATATTGCACCCGGTTAAAATTCGTATACGTCCTATCCGTAAACTTGAGATTATAA
ATTATACAACTAATCCAATTGGGCAAACCTCGAAATTGTCCCCTGCAAGAGGGTCCGGTGCGGGGCGGGGGGTGCATAATCAGGGCCCAGGGTGCATTGT
CTCAGTTCACTGCACTCGAAATTGTAGTAGGCTGTAGAGAAGATCCGTTTGTCAATTGCACCCTAATTTCGTAGGTCATTCTAAATAAGAAATTCTGGGT
GTTTATTAAGTTCGTTCCGTTCGCTTCTGCCGTTCACGCCACTTCCGTTCCGTCCTTCCAGGCAATTGCGGCGCACTCCGTTCTATCAATAATCTCGGCG
TCAGTAGCACCCAGACATTCCGCAATGATAGCCTATTATACTTATCCTAACTGGTGTATTCGCACCTTATGAATAAGAAATATGAGGTACCACATAAGGC
GTACCCGCATTATCCGAAGGATATACGAAAATGTCCTCTTGAAAATGTCGAGTGGGCTTTTTTGTCTTGCCAACTAAGATACAGAAGCTTTGAACGAAAG
TGCAAATGACACCCAATACTCGCACCATCAGCGTTATAGCAATGATCGGCCCCTTAATAGCAGAAAGATCGGCTACCTTAGCGTCAGCGAGGTTATTTTG
TGTGAAAGTATTGACCCAAAAACATACTACACTACTTACCGGGCCCATACTCCTTACTGCACAGATTCGGTAGTGCGCCGCTCAGGTACAATTCTTTATC
ACGGAGTTTAGAAGACTTTTCCGTCTTCATTTTGATTTTTTTGTAAATGCTTCTTGGCGAAAAGGACGTGTAGTTTGCTTTTCCCTCAAATATTTCTTCT
TTTCCACGCCAAGTGAATAAAAGGAGTGGTGTTGGCCGTTCTGTACTTTCCCAAGCTCAGTGAGGCTCCGCAAGGTTGTTTTTTCAATTATCTAGTCAAC
AAACGTCAGAATTTACATTGGGATACAAGAACTGTGTTCAAACCCATGATATTTTATTGAGAAGATGAAATCGAGCAGATGAAATCGAGGAGATGAAATC
GAGCAGATGAAATCGAGCAGATGAAATCGAGCAGATGAAATCGAGCAGATGAAATCGAGCAGATGAAATCGAGGAGATGAAATCGAGCAGATGAAATCGA
GCAGATGAAATCG

1,513bp truncated ...