Sign In

S. eubayanus strain FM1318 ( SEUB3.0 ) - NW_017264706.1
Saccharomyces eubayanus strain FM1318 mitochondrion, complete sequence, whole genome shotgun sequence

>NW_017264706.1 Saccharomyces eubayanus strain FM1318 mitochondrion, complete sequence, whole genome shotgun sequence
TATAATTAATTAATTAATTAATTAATAAATAGACTTTATATAAATATATATATATTATTATTATTATTATATATAGCCCCGGGCCCCCCGAGCCCGGGAC
CCCGCTAGAAGTATATATTATATATTAATACAGATAGAAGCCAAAAGGTCAGGCGCTTTCTTTGGGAGAAAGACCTAGTTAGTTCGAGTCTATCCTATCT
GATAATAAAAAAAAATAAAATTAAATCAAATATAAATATTCTTTATTCATATATATTATATTCTCCTAATGGTATACATGGAATGATATTTTATATATAT
ATTCTTTATTTAAATTATTATTATTATAAAATATTTAATGAAACTTTATAATTAATTAATATTATTTAGCCCCGCAAGGAGTCCCGGGCCCCCCGGGGGG
CCCGGTACCCCGCAAGGAGATATATTATCTATATTAAATATATTATATATTGTCATAACTTATTAAATTTATTAAAATATAAAATAAGGACATATCTTTA
TATTTATCCTTCGGTACTTTATTTATTATATATTATTATTATTATTTATTATTATTATATAATCTCATATAAGATTACTATTATATATTATATAAGATCT
ATCTATTGTATTAAATATATTATATTTTATATATTTAATCTTATATATTCATCTACGGTACTTTATTAATATAAAATATATATTCTTTATTTATATAAGA
TATATATCCTATTAAAACATATTATATTGATTTAATATTATTATTAGTCTCAGTATTAATTATATTTATATATATATTAGTTTCTCCTATCGGGACTCCT
ATATTAATTATATATTATATATAATCTATTGAAAATAACTATTAAAGTAAATTATTATATTATTATGTATATTCTTATTAATATTTTTAATAATATAAAT
TCTTATTAATATTTATTAATTCTCCTACGGCGTCCGATCCCCCTATTAAAGTAAATAATTATTTATCATAATTTATAATTTATTATATATAAATAGGAGG
CCGGACTTTATTATTATATATTATATTATTTATATATATATATGATATAGTTAGTATATTAACTATATTTATAATTATTGGTTATATATTATTATCATTA
TTATTATTATATTATTTTATATAAGGTTATTTATTATTATATTATTTCATATAAGATTATTACTATATTATACCTTTATATAAGATATATATTGTATTAA
ATATATATATAGTCATTAAATATTATTATTAGTTTCAGTAATTATTATTATTATATTAATATATATATTACTTTCTCTTATCGGTACTCCTATATTAATT
ATTATAATATTTTATCATTATAAAATAAGATAAGATATATTAAAGAGTAATTATTAAAATATTCATTATAGTATTTATTAATTATTTAATATTTTTATTA
ATTATTAATTATATTATTATTATCATAAGAAGTATTACATAATATATATTCTTATTAATTTGTAATATTTAATATATATATTTTTTATATTCTTATTTAT
TATATTATATTATATTATTTTTTATAAAAAGTTATTATATAAAACTTTATATTATTTATTTATAGGTATATATTATATATAATTTATTATATTAATTTAA
TTTAATATTATTATTCTTTAATACTTTTAATAACTTATAATTATACAAGAGAAGAATATATATATATATTTGAAGTATATATATTTAATTATAACCTAAC
CTTTAAGATGTTATAAAATATAATTTATTATATTATTATTTTATTATTATTAAAATATAATCTATTATAAGGTTTTATATTATTTATTAAAATTTATATT
AAAAGATATTATATTAATTAAATATTATTATTTATAATTATTAATCATTAAAGAAGTTATTTAAATAGAATATTATTAATTATTTTAACCTTATTACTAG
AAGTTTTACATATTATATATTATATATAGTTTTATATATATATAGGATATAATTAAAATATTAAATATAATCATTATTTGTTATATAATTTTTATATAAA
CATATATATACTTATTTTATATTATTTTATATTATATATTATTATATTCTTTTTATAATATAATATCCATATCCATATCCATATCCATATCCATATCCTA
TAGGGCTTTATATTATTTATTCATAATACGTAAATATTATTAATCCTATTAAGTATAATCATTAATTCTTTATATATATATTATCCTTTAGATATATTTA
TATAAGATATATATATTACCAATAATATATTATTTATTCCTCTCATTAAGAATAATTATTATATTCTTATACATATTAGTTATATAATTATTTAATATTC
ATATAATATTTATTCACTATTTAATCTCATATCTATTACTAGGAGTATTACATAATATATAGTATTAGTTTGTATATATATATGATATAGTTAATATATT
TAATATAATCATTATTTATTATATTATTGAAATATAAACATATAGTCGGGCCCGCCCCCCGGGGGGGCCGGACGCCGGAGGAGGATATATCCTTATTTTA
TATTTTAATAATTAGTTATTATATAATTGTCATTTTATTATTATTATTATATAATATAATCTTAATATTCTCCTACGGGACTTTATTTAATTTAATATAA
TGTATTATAAATCATTATATTTAACCTATAATTAAATATAATTAATAAATAATTATACATATAATATTTTATATATATATAATTTATATAATATTCTTAT
AATAGTCTAGTTAATAATCTAACCTTTTTATTAAAAATAAGAAATATATAATTAAGAAAGAATTAATAATTATAATCTTAACTATAATCTTTATAATATA
ATTTATATTAAGATTAGTTTAAGTATATATATTTAAGATATAAATAATTATAATTTATTAGTTATAATTGAAATATAAACATACAGGTTATATCCTTATT
TTATATTTTAATTATTATGTATTATCATTTTATTGTTATATTATAATTTTATTATTAAAAATAATATAAATAATTTACTAAATTAAATAAATATCATAAG
TATAATATAATATTATCTATTTAAGACTATTAATAATAATTATATAGTTCTATAATAAATAATAATTATTTAAAATATATTAATAGAATAAGGTATATCT
TCAATAATAATAAAGAATGTATTTATAAGTAATATGTATAATAATAATATTATTAATATTTAATTAATAATATAAATTTCATTAATAAGTTATTTAATAA
TATAATTAATGATTTCTCTGAAAAGAGTGTATATATATATTATATATAAACTATGATACGTTTTATAAAACAATATATATATATATATAAATATTTATTA
TACTATTACTTTATGTTTATCATAAAGATATAAATAAAATAGTTTAAAGTTATAACTATAATATTATAAATATTATAATATTAATAAAATTAATATATAA
ATAAAAAAATAAAAATGGTACAAAGATGATTATATTCAACAAATGCAAAAGATATTGCAGTATTATATTTTATGTTAGCTATTTTTAGTGGTATGGCAGG
AACAGCAATGTCTTTAATCATTAGATTAGAATTAGCTGCACCTGGTTCACAATACTTACAAGGAAATGCTCAATTATTCAATGTTTTAGTAGTAGGTCAT
GCTGTATTAATGATTTTCTTCTTAGTAATGCCTAGTTTAATTGGTGGGTTTGGTAAATAATATATAAATAATAAATAATAAAATACTAAAAATATAGATA
ATAATAATGATCAATATAATAAAAAGAAGTTATAATCTTATTTAATAGGTTTAATTGAAGGTGACGAATCTATTTATGTACTTTATAAAAATATACCTAA
AAATATATATAAAATTAACAATTATATTTCTATTAGATAATATATAATTAACTAAATATTTATATAATTTATTAAGTATTGAAAGATTAATAATAAACTT
TAATATTTATATAATGTAAGAATTATAATAAAAATTAACTTATTAATAGTAATTAAATATTTAATAAAATATCCTTTATTATCTAATAAATAATTAAATA
ATAATGATTTATATAATTTATATATATTTTATATAAAAAAAATAATGTTTTAGTTATACTAATAGTTATAAAAAGCTAAATAAATATAGTTAGTAAATTA
TTATTTAATGATAATTTATGATTAATTATTAATTAATAGGGCGGACACCGTAGGAGATTAAATTATAATTATCTTATATTAACTTAAAATAGAGATCATA
AAAATAATTTATATTAAAATAAATAGTTCTATTAATAAATAAATAAATAGGATGTAATTATGACAATAGTATTATATTATTTATAATCCCTCTAATATAT
AATAAATATATTATAAATTAGTAAAAATAATTGCCGTAATATATTATAAAATATATTATTATTACAACACTATATGCGGGAAACTCCTAAAGTTATAATA
TAATATAATGGTAATTCAATTAAATTATGAATATACTATAATATTAAAAATTATTATAAATAATATATCCTCAATTTATAAAAAGGGGGATTAAGTATGG
ACAATCCGCAGGAAACCAAATAATAATATAAATATATATTAAGATATATATATATATTTATTTATATTTATATATACTTTTTTTTTCTATAGATTATATT
TATATTATCTAAGAATTATATATATAAATTATTACGTAGGATCCTCAGAGACTACACGTGTTGCACCTATTATATTTTGTATAATAGGTTGAAGATATAG
TCCAAATATAATTGAAAGATTATAATAAAAATGAATTATTTATTACCATTAATAATTGGTGCTACAGATACAGCATTTCCAAGAATTAATAATATTGCAT
TTTGAGTATTACCTATGGGATTAGTATGTTTAGTTACATCTACTTTAGTAGAATCAGGTGCTGGTACAGGATGAACTGTAAATAAAAGGATATGCAGTTT
TTAAATATCATTTAATGCATAAAATACCTTATATATATATATAAAAATATATATAATTATTAAAATACTTAATATATATTATATATTAACAAATATATAT
TAGTTAAAAAGTTTAATAATATAGGTTAATATGCCAATATTTTAATTAATAAAATATTTCAGAGACTAAACATGATATAATATATTAATAATGATTATAT
CATTAACATTTATATTATTATAATATAAAGTATATATATATAATAAATAAGAATAAAAATAAAATATCATATATATATTATTAAATAATATATAGTATAA
ATGTATTATTAATATATTAAAGACATAGTCCGAACAATATAGTAATATATTGAGATATAGATAATAATATTTATATTAACAAATATACTAATTATATAAT
TATATTATAATTATTATTAAATAGATATCCACCATTATCATCTATTCAAGCACATTCAGGACCAAGTGTAGATTTAGCAATTTTTGCTTTACATTTAACA
TCAATTTCATCATTATTAGGTGCTATTAATTTCATTGTAACAACATTAAATATGAGAACAAATGGTATGACAATGCATAAATTACCATTATTTGTATGAT
CAATTTTCATTACAGCGTTCTTATTATTATTATCATTACCTGTATTATCTGCTGGTATTACAATGTTATTATTAGATAGAAACTTTAATACTTCATTCTT
CGAAGTTGCAGGAGGTGGTGACCCCATCTTATACGAGCATTTATTTTACCCAGACTATAAAATAAATATAGTGAAAATCATAATTCTAAGTTTATTAATA
ATAAATATTTTAACTATTAATATTGTCTTTAATCTATTAATAATAAAGACTATTTTATCAATATATAATAATATTGATAAAACTATTAAATTAATAAATA
AATATAAATTAAATTTATATATATTTTTTATAAATATTATTAAATACTTTTATATATTATTATTTTATAAAAATCTTAAAACATTAAATAATAATAAAAT
AAAATCAGAAGATAAATTAATAATTAATAAAGAATCTTCAAATATGAATACTTTAAAATCTTTATTAGATTTAACTAATAATGATATTAGTAAATATAAT
TGAGAATGAGATAAAGATAATTTTAATTTTGATAAATTTTATATAGAATTTAAAAAGATTAAACCAAATAATAAATTACCAACTAAAGAATTTTTAGAAT
GATTTATTGGTTTTTTTGAAGCTGATGGTTGTTTACTTATTCCTAAAAATAAACAAGTATATGCTATTATTCTTTCTAATAGTAAAGATTTAAATCTATT
AAATTATATTAAAGATAATATAACTTTTGGTAATGTACTATATCATTCTAGAAAATTAAATACTTATAGATGAGTAGTATATAGTGAAAAAGATATTATA
TTATTAATTCATTTATTTAATGGTAATCTAGTATTACCTGTAAGATATATTAAATTAAATATATTTATTTCAACTATTAATTTAAAATTAATAAATAATA
ATAAACTTATTATTAATTTAATTAATAAATGTAAAATTCCTCTATTAAATAATGCTTGATTATCAGGTTTTACTGATGGTGAAGGTTGTTTTTATATTGG
TAAATCTCAATCTTATTATTATCTAAGTTATAGTATTACTCAAAAATATTTAGCTAATAAAATTGTTTTTGATATAATTTTATTATTATTACAAAATATA
CTTAATACTAAATCAGGTGGTGTTAATAACCATTCTAAAGATAATGTTTATATTTTACGTATAAGCAGTTTAGAAGCTTGTTCTAAATTAAGATTATATT
TTAATAAATATCCTTTAAGAAGTTATAAATTATTAATTTATAAAGATTGATTAAATTTTATTGATATAGCTATAAATAAATCTTTAACTAAAGAGGATAG
AAAGATTAATTTAATAGTCCGGCCCGCCCCCCGGGGGGGGGGCGGACGCCGGAGGAGAAATATTAAAAGTTATTAGAAATAAAAAATTAAATAATTAATA
AATAAATTATGATGAGAAATAAAAGATATAATTAAATGTAAATTTATATATAAATATTAATTATTTATATAATATTTCATATATATTATTTTATATATAG
AGTATGTTATATCTTAGTTTTTATATATTATAATTATATATATACTTATTTATATATATAACATATAAATTACTAATAAATATAATTTATTGATAAAATT
ATCTTATTATGAATAATATTAATTATTATAATAATAAGTTTATATTTAATAAAATATAAAGATATATAAAGGCAACACTGATAGTACGGTTAATAATCTT
CTTAGGATCAAGACCGTCGATTAATTAAGTGATCGCTACAGACTGCTTTATCGGTGGTTTTTATAATATATATTATTATAAAGATTAATGTACAGTCGAT
ACACTCAATAGATATTAATTTATATATTGGTTATTATAAATTATAATAAGTAAAATATATTGTAAGTGTAATATTTATATTTTATATGTGTATGGATTCT
TTGGTCATCCAGAGGTATATATTTTAATTATTCCTGGTTTTGGTATTATTTCACATGTTGTATCAACATATTCTAAAAAACCTGTATTTGGTGAAATTTC
AATGGTATATGCTATGGCATCTATTGGATTATTAGGATTCTTAGTATGATCACATCATATGTATATTGTAGGATTAGATGCAGATATGAAAGCTCAAGTG
TCGTTATATATGGTAACGTATATATTATTATTTAACTGTATGCCGGAAACTTTATACTATTTTAATAATAATAATAATATTATTAAAATAACTAAAATAA
TAGTCCGCTTATTATTAATATATTTGGAAAAATCTATTATTTTATTTAGATATTTTATAACTAATAATAAACAATCGGCAAGTAACTTTTATTTTACTTC
TATAAAAATTAATAAGAATAAAAAAACAATTCTTAAAAATCATTTAAATGATATAAATGAAATAAAAATCTCAGAACATAAACCTTTATATAAAAAATTA
AAAGATGATGAAATATTAGGTTATTATTTAGCAGGTTTAATTGAAGGAGATGGTCATATCGGTGCTAAATATATTACTATTGCTATTAATTATAAAGATA
TTAAAAATGCTTATTATTTAAAAAAATTAATTGGTTATGGTAATATTAGAAAATACTCTAATACTAATAAAGCTGTAAGTTTAAATTTTGATTCTAAAGC
AGCTATATTAAGAGTATTTAATTTAATTAATGGTAAATTATTAGGCCCTTATAAGCATAAACAATTAATTGATCAAAAATACGATATTAAATTTAATACT
TTAATTAAACCTATCGCTAATTTTAATTTATGAGATAACCCCTGATTAACTGGTTTTACTGACGCTGATGGTAGTTTTGGAGTATATGTTTATAAATCAA
AAACTATAAAAATAGGATATAATGTAAAAATTATATTTAGAATTATACAAAGACATGTTGATTTATTAAAACATGTTCAAAAAGCTTTAGATGGTAGTAT
TTCTTTATTTAAAAGAAAATCAGTAGTTGGAGGTTATAATTATTCAGCTCTTAATTTTAATTCTATTAAAAATTGAATTAAATATTTTAGTTTATATCCA
CCATTACATAATAGTAAATATATTCATTTTATTAAATGATATAAAGTTTGTTATTTATTTGATAATAAATTACATTTAACTAAAGAAGGATTAGATAAAA
TTATATCTATTAAAAGGAACTTCAGAGACTAGTGCGTTAAATATCCTATATATCAAAATTAAGCATTTAATCCTTTATTATATATAAAATATATATATAA
TATAAAATAATTATCTTATTTATTTTTAATTAGAAATAAGTTTTATAGGATAAAGATACAGTCCACAGTTAATAAGGTTTGTTTATATAATATAATATAT
AAAAATATATATATAAAATAAAATAGAATATAATACTTGTTATTGTCGAAAATAATATCTCACTTTAATTAGAATTATAATTTAAATTTTAAGGTATATA
TATTATAAAAAATTATAAAACTTATTCATCCTTATTTAATATTATTATATATTTATAATAATATTTAAGTGACTAGAGCCTATTTTCTTTCCGCAACTAT
GATCATTGCTATTCCTACAGGAATTAAAATCTTTTCATGATTAGCGACGATCTACGGTGGTTCAATTAGATTAGCACTACCAATGTTATATGCTATTGCA
TTCTTATTCTTATTCACTATAGGAGGTTTAACAGGTGTAGCTTTAGCTAACGCCTCATTAGATGTAGCATTCCACGATATAAATATATTTATTTATTAAA
AATAAGTGTCGTGTATAAAATTCACAAAAATAATAAATAATAATTATATTATTAAATATTATTGGTTATTATATTTATAATAATAATATTTATATAATAG
CTAACGGGGAAACTCTTATATATATATATATTATATAAAAAATAAGACAATCCCGTGATAACTTTAATATATTCATAATTATAATTTTTTTATATATAAT
GATATATTAAAGTATTGTAGAGACTAAACGTGAATGATTTTAATATATTATATTAAAATTAAGAGATAGTCCAATCTTATATGTGAATATAAGTTAATAA
AAATAATAATATTATTTTGACTTATTATATATTTTTATATATAACTTTAAATTATCATATTATATTATATTTATTATTAATAGATAATATTTATAAAAAA
ACATATGAATCAATTATAAATAAATATACTAATGTAATAGATAGATATTTTATTAATATTGATAAAGAGAAAATTAATAAATTAAAATTTTTAGATAATT
ATACTGAGGATGAAAAAGGTTATTATTTATCAGGATTATTTGAAGGAGATGGTAATATCTATACAAGATGTTTTACTATTATTTTTTCTTTAGAAGATGT
TATTTTAGCTGATTATTTATGTCTTTATTTTAATATTGGACATATTACAGCTAGATATAATAATAAAAAAGAATTAACAGCTGTTGAATGAAATATTATA
AAAAGAAAAGATCAAGAAGTTTTTATAAATTATATTAATGGTAAATTATTAACATATAAAAGATATAATCAATATTATAAATATAATTTTAATAATCTAT

57,999bp truncated ...